Description :
From Genome Similarity Track
Location :
scaffold_1775:3- 1916
Transcript NameFunction/comments
g11684.t1 PREDICTED: uncharacterized protein LOC101063318, partial

Sequence
1913 bases(100 bases per row)
AAGTTCGACTTGGTATTAGGCATGCCGTGGCTTGCACGGCATGACCCGGTGATCAACTGGGAGAAGCGTACGCTTGTACGCTTCAACAGCATGGGCGCGA
CAGAGAGCGATGGCCCTGTCAGTGCCGCGCATGCACCGGCCGGTGAATGCGACTCCCCGGTTGAGGCAGCAGCGGCCGCCGCTGCCTCCAATCGCCGCCG
CCGACGCTTGACGACTCCGGGAGTCGTTGAGAGAAAATGTGTTTCGACTCAGAAATCTGAGTCTGAGCCGAAGGGTCGCCTGAGCGATCACGTGAACAAA
TGTCACGTGAATGAAGGTCACCTGAATGCAGGTCACCAGATTGATAATCATCTGAATGATGATTGTCACATGAATAAAGGTCAGGTGAATGAAGTTCACC
TGAGTGATGGTAACATACCGGTATTACCGGTATACTTGGAGCCTCCAAGGGTCGCGCCGACGACAGCGCGTCAGCTCTGGGAGCTGACGAAGCCAATAGA
ATTCCGGTTCAGGGAACCGATGGACGTGCGTCAGCTCCGGGAGCTGACGTCCCAGGCGCAGGGCCGCTAGTTCCGGGAACTAGCGATCGCACATCGGCTC
CGGGAGCCGATGATACAAACAAAGGCCACTAGCTCCGGGAGTCGACGATGCATTTGATCCATCAGCTCCGGGAGTTGATGGAGGCGTGGCAGCTCTGGGA
ACCGACTACGCGGCAGGAGGTGCTGGCGGTTGCAAACGTCCAGCACCAGAACAACCTGCGTGCTCACGTGCAGCAGTGCTGCACGCGATGAGCGGCACAC
AAGCCGGGCTTGATTGTGCGAGTCAGCTGAAGACATCCGCTGACGACTATTGCGATAACGACCCGTCCAAGGCGAAGGCCCTTGGACGCGGAGCACCTGG
AGCCGGGCTCCAGGGAAGAACTTCACGGCGCAAGCCACAGAAGCTGCGCGAGGCTCAGTCCGGGACTGAGACGGGTGTATCTGCCGAGCAGACACCGAGT
GTCGAGACGTTGAACGTCTTGACACGTACTGGTACTGGATTCCAGTACCAGAAGATGCGGTTAGAGAATCCGCCGACGTGTGCGTCGGCGTTGACCGCAC
TTCCGACTATGAGTTGTAAGCGCTTCGCGCGGGACTTGTACGATGGACGCATCGAACAAATTTGCATTCTCTCAGACGTTGAGAGGGTGGAACGCGAGGC
CAAAGAGCTGAAGCAGCTCGTCGTCGACGGGATCACTGAGGGCGATGACCCCCTCAGTGCGAAGACCAAGAAGCAGCGCTTCGAGGAGCAGAGTTGGGAC
TCGTTGAGGTCGAGTCCCTATTACGACATTCTGCGGGAGTACAAGGATGTACTTTCTGACGATATTCCTTCGGAGCTTCCGAAGGATAAGGGCGTACAGC
ACGAGATTGATCTCGTGCCGGACACGAAGTACTGTGTCACGCGGCAGTGGCCACTGCCGCGCGAACAGGTGCAAGCGATCGACGACTTCTTTGAAAGTCG
TCGTCTTGCAGGTCAAGTGCGGGAATCGAAGTCCCCGCACAGTGCCCCGACGTTCTGTGTCAAGAAGCTACAGGGCGGCTGGCGCATCGTTCATGCGTAC
AACAAGTTGAATGATGCGACGATACCGGCGCAGACCCCGATACCGCGAAAAGATGTGATCATCGATTCGATGGCCTTGAGCACTATCTTCAGTGCTCTAG
ATCTACGTGATGGATTCTATCAAATCATCATGCGTGAGAGGTATATCCCTCTCACGGCGGTAAGCACTCCAAGCGGTATGCTTTGGGAGTGGCTCGTCAT
GCCACAGGGACTTAAGAATTCCCCTGCGATATTCAATAGATGCGTGACACATCTATTGCGCTCGTTGCGCTACTTCGCACCGAGCTACTTCGACGACGTG
TTCGTCCACAGCC