Description :
From Genome Similarity Track
Location :
scaffold_1927:3- 1910
Transcript NameFunction/comments
Pl_100232pol protein

Sequence
1907 bases(100 bases per row)
AAGGTTGATACGTTTTGGCAAACGATATTCCGCGTATTAGGAACCCTATTGCTTACGTCAACCGCCGACCATTCACAAACGGACGGTCAAACCGAGCTAG
TCAATCGTCGGAGACGCGCTACGCAGTGTCTGAGGTGAGGCACCACGGTTATAGACGAAGCGCTTACCCATGGTTGTGTTCACAGTCAACAACGCGGTAC
ACGCATCAACGGGGTTACCCCGTTCTACCTGAATGGGCTTCGCCACCCAACGGTGTCGCTCACGTTGCGCGGGGCCACCGAGGATTCAATCCTAAGTGGG
GGGAGGCTCGCAAGGCCTTTTCCTCCCAAGTCTCTGAGGTGAGACCAGTTTCGTTACGGAAACGGTTGTCACTCTTTGTTGACAACAAGCTGACTCTCAT
CAACAGGGTTAGAGACGCTATGGCGGAAGCCTAAGACAAATAAAAGGAGTACTCTTAGCGACATGGAAGAGGAAACTCAAACGTGTTTAAGGTGGGTGAC
CTAGTCTTACTCGTCACTAGAAACCTACCTCTAACTTGGTTAGCATTGCGGAGAGAACCGAACGGAAGCACCGCTTCATCGGACCCCTCGCGGTCCTGGG
TAGGCTCGGCACTGCCTACACAATTGACTTATCTAAGTCGATGACGACCCATCCGACGTTTTATGTGGGTCGCTTGAAGCGGTGCCATGACCCGCAGGAT
CAGAGTGTACCGTCGGATGCGGTGGTCGCCCACGCACCGATGAGTCAACCTCCTCAATCAGAGGTTGGCTACGAAGAGCCTCGTGCTCAGTCGCCGTTAC
CGGTCGCAGATACAGCCGACTGGCATAAGCTGGCACGAAAGGCTGCTGGGCGTACGGCGGATGTCGATACGCATGCGACTCGTATGTCGCGTATAAACCA
TACGAATGGGAGTACGCAAAGAGTTGAGACTCCCAATAAGTGGATGGACGAGTCATTCGGTACAGGACCCAGCGCTCCAGGCCCTCAAGGTCAGCCTTTG
TCGCACGACGACCAACGCGCTGATGGAGCCCTCGGACCTCGCGGTCCAGTGATTCCAAGTCCTCACACGGCGAGGAGCAATTCCTGGTTGGTCAGACTGC
AAAACAGCGTCACCACCAGGACCTACACCAGTGGCACACTCCACCGCGTACAAGCGGTGACGGAGTTGGTGGGCATCCTTTGCCATCAGAGCCAGTACCT
GGTCTCGAGGATCAACCGGGTCCTCCTGATCCACCTCCCTCAAAGGTGGCTCGTACGAGTAGTCGAGATCGCCCTCCTCGACCGAATTTAGAACTCCACT
CCCACGTGGAGCGTGCCTTCAAGTAGTAGCGCCCCCAAAAGAAACGCCAGCCGAAAGTGAAGTGGCAGGGCTACCCGACTTCACAGAGCTCATGAAAACC
CATCGAGCAGCTACAAATGGACTGCCCAACGGCTGTCGCAATCTGGGAACAGAAGCGACGCCTTCGTAAGTAGTGCGCTGCTTCTTAGCAACTGTACGGA
GTGCGGCAGACGTATACTCGCCACGCTCGTACTCTCTCTCTGGGTAGAGGACTGGGTGTCTCTCTTTAACCCCGCCATCTCAGTGATGAGTTTTCGCCTC
ACGACGAGGTGAGCGAACTGAACCCGAAGGTCCCGCTGGAGCAAAATGCAATTCAGCTCGGCTTCAGCCTGGAACTCCTTGATGGAACAACCTATGAGGG
TGACCCACCTCCAGAACAAGGCTTCAGTCAGTGTAGCCGTGAAGGCGTTCTCCGGCTGCACTCATGGGAAACCCCACACTGTGTTGAGGTAACCTTTGAT
CTCAGGTTGCTTACGAAGACTAGTGAACTCCTGCAGTAGAATTCTGGGCGGTGCAAGAAGCACGCACCTGGTGGCCTCTATGTTCTCAACGAACAGAGCC
ACGTCTT