Description :
From Genome Similarity Track
Location :
Scaffold_687:3- 1881
Transcript NameFunction/comments
g10345.t1hypothetical protein

Sequence
1878 bases(100 bases per row)
GAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAAGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCT
GCGGAGTTACCGCAGGACAAGGGTATTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAG
TCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCAACGTTCTGTGTGAAGAAACC
ACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGGCACAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCG
ATGACCTCGAGTACTATCTTCAGTACTCTGAATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACGGCGGTAAGCACTC
CGAGCGGCATGCTCTGGGAGTGGCTCGTAATGCCACAGGGGCTAAAGAACGCCCCAGCGACGTTAAACTGGTGCGTCACGCACTTGTTGCGCTCGGTGCG
CGACTTCGCACCGAGCTATTTCGACGACGTGTTCATTCACAGCCGGGCTGTGAATGGGAAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTG
CTTGAGCTCATGCGAACGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGAGTGTCTCGTGGGGAAGAACG
GCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCACTGAATGGCCTACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTT
ATGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCC
TTCGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGCCCGACCAAGATCGCCCATTCCACGTTGTGTGTGATGCATCCGATTTCGCGA
TCAGATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACA
TAACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTG
CGTACGGCGGTCAAGTCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGGTTGAGTACAAAGCTGGAAGGT
TGAATGTCGTGACCGACGCGCTTTCGCGTCGACCAGATTATGCGGTGCAAGAGGCCGACGCCAACGCAGTTGGCGTCGTCAGGACGACCACACCCTCGTC
GTCCTTGCTGGACGAAGTGAAGGCCGCATACGCACATGATGCGGATGCGAAGCAATTGTTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAG
CTGACCAAACACCTTCGTGCCCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGC
CAGATGATCATGAGCTGAAGCTCAAGATCACGTACGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGACATATTTATTTCTCACGCG
TGACTTCTACTGGAGTCACCAGTACAAATGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGCGTGAAGCC