Description :
From Genome Similarity Track
Location :
Scaffold_598:3- 1855
Transcript NameFunction/comments
g16401.t1hypothetical protein

Sequence
1852 bases(100 bases per row)
GTACGACTGGTGAAGGTTACTGGCCAGTACACGCCATCATGATCTTGTACGAGTGCCGCGGAGATCGCCCACTGGCTCGCATAGACTACGATCACCGGGG
TGCGATCTGGATCGAAATGTTTCAGTACCGGGGTGGACACGATCTTGGCCTTCAGCATCGTGAATGCGATTTTCGCTCGGGCCCAACGGTCAGCATCTTC
TGCTCGCGTGACAACGCCCCCAGCTACTTGTTCGCCGGGGATGGACCTGTTCTGCTGAACTATCTCGTGGAAATCCGCTTCGCGCAGCTCGTACAAGACA
GCGGCGTAGACCGCGAAGTCTTCGATGAAACGACTGTAGTAGTTCAAACTTCCAAGGAAGGACTGCATCGATCGCAGAGTCTGCGGGAAGGGAAGGTTGC
CTAACACTTCAAGATCTTTCGGATGGGCTTCCAAACCGTCGACGGACACTCGGTGTCCCAAGTAGTCTACCTTTCGTCGGCCCCAGAAACTTTTGACCAC
ACTGATGGACAAATTCCATCGTTCGCAAGCATCGAGCAGTGCTTCAACCTTCTCACACAGCATGTCCCAAGTGATCGCAGTCACCAGAATATCATCGATG
TACGATCGCCTTCCTAACACTGACGGTCTCGGCTCTGGTTCTGGCTCGCCTGAATCGAACACGTCGATCGGTTTCGACGGATCGTGACCGGCGTGGATTC
GGAAGTGTCCATACAGCGCGTTATCAATCAATCGCTGGTAGATCTGTGGCGCATTCTTCAACCCGAAAGGCATACGCGTCCACTCGAACAACCCGAACGG
TGTGATGAACGCAGAGATCTTTCGTGCGCGTTCTGTCATGGAGACTACCCAGAAGCCACTTGCCATATCGAGTGAGCAATACCAGAGCACTTTGTCCAAG
TCTTCCAAGAGATCGCTAATCAGCGGCATGGGATACACCATCAGTCTCGTCAAACTATTCACCAGCCTGTAGTCGATACAGAGCCGGATGTCAACGCCGT
TCTTCTTGATGATGATTACGATCGGAGAGGCCCACGGTGAAGTCGACGGCGTGATCATCTTCGCCGATAACAGGCTTTTGATCAGATCCGACAGCTTCTC
ACGGAACTGGGGAGCGACTTTTCGGACACGTTGTGCAACAGGAGCTGCTCCTCCCACATCGATGTCGCAGACTGCGCCAACGGCAGCTGGTGGTAACGCG
TTCCCCTTCCCGATCAGGAGATATTTCCGCCTCCAAATTATCTGCCGCAGGCGGTCGATTTCTTCCGGGGTGTTTGACTCAGGATCGCCCACCTGGATAT
CCTCGACCGTGACTTCATCGGTGGTGGTCACTACTTCCGGCAAGATTGCCATCTGTCTCCCCACATCTTCCGCGAACAGGTCGCCACCTTCGTGGTAACA
TACTTCTTCGTCATCCAGCGGTTCCGGATCAACGATCGGAGGCGTTTCAGCCTGGGGCATCGACTCCTTCTGGTCCGCAGTCATCTCGTTTCGTGTGGCC
TGCTCCATTGGCGGAGATTCTCTCGCGTCCTGATCGCCGGTGCCACCTTCCTGATTCCTTGGAGACCCCTCAGCTTCTGGTTTCATCTCGGCGGGTCGAG
GCACGGTTAGTTGTGCGACGACCGATCTCGAGGCTCCGCGGTCACGACGCAGGATTTTCATCGGTGTGTCGTACTGAGGTCGATCTACCATGGGTCCGGT
AGGAGCGAGTTCATGCTCTTCTACCTCCACATGGTCTGTAGTAGACTGGAAAGCTAGATTCTGCCACTCGGCATACCTGCGCGATCCAAGTAACACGAAA
CCGGGAGTGCGAGGTACGCGTCCTCCTTCAAGCCACATGCCGACATGGGTGT