Description :
From Genome Similarity Track
Location :
Scaffold_3904:3- 1705
Sequence
1702 bases(100 bases per row)
GGCCCCGCTAGAAGATCCGCAAAGGTCAGACACTTCTCATGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCT
CGGTCCTCATCTTGTTCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGG
CTGTTGCTTCCACTGCTGACGAAGTGGATGGGCCGTCCAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACGGACTCCATCTCCACGTC
TCGTGCCCCATGTTCGTGGAGCACTTGCGCTTGTGGCACGGGCGTTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGTCGCTGC
AGGGTACCTGAGGAGGTGTCGGAAGAGCTTGTGGCCGGCTGGTCCACTGGCGAGACAGGATCCGTGAGGCGATTACCTTGAGTCCGATCTGACGATAACC
CCACTGATTTCTTGCCGGATCTGGCTCGATCCTGGCTGGATTGTGTCAGATCACGCGTAGGGCCTACTGGATCCCGAGCCTTCGCGCTCACAGGGACTTC
CTGTCCTCGGCTCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGGG
GCGGATTCGTTGTTCGAGGACGCAGCTTGGCTGACCCTCGGCGACGACACCGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAGCTCTGGCAA
AGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACG
TAAAAGATCCTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCTCTTGGATCTTCGATCTGTCATGGATTCAGGATCTGCATG
ACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCTGAACAGCCTGACCTGGATCCAGCTTTGTCTTCTT
CCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGGGGTTTGGTTTAGGTACAGTGTTGG
CTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTTCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAG
GGGACCTGGGGAGGATAGAGAGGATTTTTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCG
GATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACTTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGT
GAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGC
CCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTTGCTCTCTCG
GT