Description :
From Genome Similarity Track
Location :
Scaffold_2495:3- 1695
Sequence
1692 bases(100 bases per row)
CTTGTTCTCCTATCTTGGAATGGGACCTTCAGAAGATAGGACAATTCATCACCTTCAGTGGATCAAACTCCCTTTTTAGTACGGGTCGGCAACCTCAGCA
CTCACAGCGAGGTCATACACCGTAGACCCGGCAAGGAGTTTATCGTGGTCTATTCCCTTTGTGAAACACGGTCGGAGATTCTCTGGGAAATCGTGATCAC
TGCGTTGACGTCCTCTCTTTAAGAAATTTATCCGGTCGGAAAGGGATGCAGCTCATCTTCAATCCACTGAATCGATTACCAGTAGCCCAAGAGGGCTCAA
TATCCCTCTTCTCGTTCGTATCGGTTGAGAGAAGATACAAACTTCGGCTCTTGCAGCTCCGAGAAGACCACAAAGTTCGACTCCGTGGGCAGATCCGGCG
ATGTATCCACTTGAAGGCGACTGTGCACGACACCAGACTCTTCTCCAGTGTAGGGAGGGACCATGGTGCCCATACGTTTAGCGTATGCCGAGGCTGCTCG
ATATGCGTGTTTGATGTCCTCCACATCCACGCCAGAGTCGAGCGGGTGCACGTCAAAGACCACAGAGCATAGAGACCCCGAGTCTGTAGGGAACTGGGCG
GTCTCACGACGTTGTTCGGCTGGGTCTCGTAAGAATTGTATACGTTTATCCATAAGTTGCTTGGCATCTCGCAGTTTTTGCGCCTTCATCCCTTCTAAAA
CTGAGCGACGTTGTTGGATATCACAGCCGAGATGGATAAACGTGTTGATCGGGCATTGGTCCTGTTGAATAGAATACTAGGTTGATAAAAAAATAAATGT
CAGTATCGTAATAAAAAGTGGCTTCTCTAGGTCCGGATTAACAGCGCACCGAGAGTTCCGAAAGCGCGGACTGAGCACTGAAGAGCTGAAAGTGTTGCGA
AATCTAGTCACCTGGATCTGGGCGGGATCCACCCTTTCAGTGTACACCTGGATCTGGGCGGGATCCACCCTTTCAGTGTACACCTGGATCTGGGCGGGAT
CCACGGATCCGGTTGGATCTGCGCCTGGATTTCATCCGGATCTAGCGCCAATGACCCAGGATCAATTGGGTCAGTATAGTTGGGGCCCTTGAAAGCTCGT
GCTTGAGATCAAACAGGGCTCCTCGCACGTAAAACGTCACTATTATGCATAAACATTCACTCCTTCCTCCTAATCCACCCTTTCCCTGTAGATTCGTCTT
CTCTTTCTTTCCGATGTGACCAACTCACATCAGCGATCCTCCTCCTCCTGGCCCACACCCTTCCTGTGGGCCCTTCTTCATCCTCCCATCGACATGACCA
ACTCACATCCATGGGTCCCTTCCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGTTACGGTTCGTACGATCCCTCAAGAAATCATAGAGTAATG
CTCCACAGTTCATATCTGCCTCGTCTACCCATCTGGGTTCGTCATATCCACGCCAATACACCAGAAATTCACGGTAAACCCGTCCGTATCTAGTTCGATT
CCCCGACCTCATATCGGTGATCTTCTCGACTTCGAACTCGTCGGCTTCGAGATCCACATTCCAACTATCTTCCGGTAGGAGGACTTCGTCGAAGTCGACG
CGATCGGATCCATCCACCGAAAGACGGATCTGCGGCCGATCCGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAA