Description :
From Genome Similarity Track
Location :
Scaffold_454:3- 1670
Sequence
1667 bases(100 bases per row)
CCACACCTCTCGCAGCGAATGGCGAGGTGGCTGTCGTTCTTCGCAGAATATAACTTCTCCGTGGAATATAAGCCAGGACAACTGATTGTCATCGCTGATG
CTCTGTCGCGCCGGCCCGATTTCGAACCGGCTGCGCAACCCGACACATGTCCGACCACTGTCGTGGGGTTGACGTCGAGTGTCCCGTCGTCAACCTTATT
CGAAGACATACGCAAGGCGTACGATCCGGCGATGGTGCGCTTGATGGATCATCTCTCGCAACCATCCCGTCTATCTCTTAAAAGGTTGCCCCCAGTATAT
CGATCCTCCACGGATAGATATACAGTTCACAATGGCTTACTGAAGTATACAGCCGTTGCCGGCGACACGCCTCGTGTCGTCGTACCAGACCATGGTGACC
TGCGACTGCACATCATGTATGAGTACCACGATGCACCTACTGATGGACATCGTGGTCGAGAAAAGACATATCTCACAATTAGTCGCGACTTTTACTGGCC
CCGCCAGTATCAGTTCGTGCGAAAGTACGTCCGCGCATGCGAAGTATGTCAACGAGTGAATTCAAGTCCTTCCCTTCGTGCGCCGTTGCAACCCTTGCCC
ATTCCGGCAGAATGCTGGGAATCAGTCCCAATGGACTTTGTCTTTGGATTCCCCGCAGACCCACACAAGAATACAGGTATTCTTGTGTTCGTTGATAGAT
TCAGCAAAATGGTACACCTGGTCGCTGTACCTGAATCTATCAATGCATCGTCATGTGCTCGTGTTTTTATTGACACGATCTCTGGTCTTCATGGGTTGCC
TCGTAAACTCGTCTCTGATCGAGATCCACGGTTCACTGATGAATTCTGGCGATCCATGTTCAAAATACTCGGAACGCGCCTTCAGATGTCGACCTCTGAC
CACCCTGAAACAGATGGTCAGACAGAACGTGCAAACCGCGTTCTTGAAGAAATCCTTCGGGGTTATGTCCATTCGTTTACGAATTGGAGCGAATTCTTGT
CAATGGTGGAATTCGCCATCAACAACTCGGTGCATGCATCGACGACGCATACACCGTTCTTCGTGAATGGCTTGCGCCACCCACGCCCACCCACCTTCTT
AGAGTGTACCTCTAGTTTGAGGGGGGAATTGTTCGAGCGAACGCCAACTCGGCTCTCACTCATCACGTAATGACCACGAGGTCACTACGTATGACGCCGA
TGTCGATCACATCGACTTAGGTGAAGAAAAGTAAAGTAAGAGCGAGGATGCTCTTACTACTTAGGTCACTGATCTTGCCACCGTGTGCTCCAAGCGCACT
ATAGCCAATGACAGCGAGTCAGCAGATGAATTCATACTGGCTCGCGAAACTGTTGTCCGTTTCGTGCAAGATTCCATTGCAGAAGCAGTGGACCGAAAAA
AGAAAAACGCAGACAAGAATGGAAGGGCAAAGTTCTTTCATTCAATGAATGTGACCTAGTTCTACTATCTACGGTAAACTTACCTCGACACATAGTGACT
AACGTTGGTAGTAACAAGTTACTACCCAAGTTCATCGGTTCATTTCGTGTGCTGTGCCGCTTAGGCAACGCATACACGATTGAAATGCCACGTAAGATGC
GCACGCATCCTACTTTCTACGTCGTTCGCCTTAGGCCTTATCACCAGAACGAGATTTCTTCCGGTGA