Description :
From Genome Similarity Track
Location :
Scaffold_2104:3- 1640
Transcript NameFunction/comments
Phymu_g13883hypothetical protein

Sequence
1637 bases(100 bases per row)
TCGACTTCTTGTTCACGTATGCATAGATGCAGTATCTAGAACGCTCGGCTCGTACCGGATTCCAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGACC
TTCTCAGGAAACATTCCTGCATGTCGAGTCGGATCGTACCACTTACGGATCTGGTTGTAGAATTCTTCCATGACGCATTCCCCTGCTTCATGAACCTTCC
CACATCCTCGGCACACGTAGAGACACCGATCCGTCGGGTGACCTCTCTTTCCACACTTTTCGCACGTCAATCGCCTCCAGCAATCGAGATCCGTGTGCTT
CCTGGATCCACAGTGTGAGCATCGGCCCTGATCTGGCCGATTACGGTCGGAGGAGGTCCAATGATCGGAGGTCCGGCTTCGATCCTGCGTAGGCGGGCGT
GATCGCGCCTTATCCGGCAGATGAGGTTCACCTCCCGTGATGATCGCTGGTTCATCAGCCGCAGCAAGGTAGATCCTCCTCAGGTCTCCCTCAGAGTCGG
ATCCGTCTGAGCCGGACACTCCTTCTGACTCTGAACTCGGATCATGGGTCTGGATCGCACGGATTACCGCCCTGGCGGGTGCCGCAGGCGTACTCGCTTG
GGTCNGATCTTCAGTTTGGCTCATAGAGCGGCCACGTTCAGGCGATAGAGGTAGTCTAGCGGGTTTTCTTCAGATAGCTTGCGTGCATGGTAGTATTGCC
ATGCTACGGACATTCCCAAGCCACAGTATTGTGTTTGGAAGCTGTCCAGTAGATCTGACCACTTAGTCTTGGTCGATCTACTCAGCTGCCTattccagct
cttcactgGACCGATCATCAGATCCGCGAAGGTGAGACACTTTTCCTCCTCAGTGGCCTGATCCCGCTGGAACGCGGATTTACCTTGCTGATCCAGGATC
GTGCTCGATCTTCGTCGAGATCCTTGCCGGCGAACTCTTTCAGATCCGAGATCGCCGAGATCCTGCCTCTCTGGATCACTGACGATCCTCCTTGCCCGAT
CGCGGCCGAGGCCACAGCTGCTGGGCTCGTTGTCTTCCTTGCAGAACTCGGGAACCCGAGATCATCGGGGTCATACTCCCAAGAGTGTTGATCAGGGGTC
CCGACGGACTTCATGTCGACATCCTGCGCCCATAAGTACTTGAAGATGTTGGTCAACTTAGCCGGCGTGAAACTTTGCTCCTTCAGAAACCGGTTCATGG
TCATCTGGAAGTATTCGTCCAACTTGTTGCTAGGTCCGGACGAGTTTGCCGTCGGGGTAGTCGGATCGACCGTGATCCCGTGGCCTTTTCGTACATCGGG
TGATCTAGCGAGAGATCGCGGCCCGGAAGATCGTTGCTCTTGCTCCTTCATGCGTGATCTTAGCAGTTTGGCTCCCGAGGGACCCAGAGACATTCGTTGG
AATTCTCGCGAACTGTCCGTATCTGGTTCTGATGTCGCGGACGTGTAATGTGATGATCCTGTCTGGTAGCCGGGGTCAGGCATCTGTGTTCGCTCGCCGA
CCAAGATCTTGAGAGCACTGAAAAGATGTCGGGTCGCAGACTGGATCGCGCTCAGATCCATGTCGAACAGGGAGTTCGGATCGAAATCGCCGGCCACTAA
GCCTGCCTCTTGAAGCAGATTCATGAGGATCTTCACT