Description :
From Genome Similarity Track
Location :
Scaffold_906:3- 1601
Sequence
1598 bases(100 bases per row)
TTTTGGGTTAAATGAGAACTGCTATTTTTGTTTTATGTTCCTGACTTCCTCTAAATGTAATATTCTAAGATAGGAATCTGCCAACAGCTGGTTGGCAGAA
TTCCAATGCTGTGCATGTCGCTCATTGGCTAAGAGATGCTGCTCTCAGCCAATAGGAATCCTAAGTCTCTATGGACCACCCGTCGTGGTGGTCGTAAATG
TATGTAGCCTTTGGTGTGTCTACACCAAGGTCGAGAAAGTCTTTCGAACCTCTAACAGACGTCGTGTCTGTTAAAGAGTTACAAGTGACTGTAGCCACTT
GTGCGTGTAACCCTGTTACACCATCCCCCCCCTCAAGGTTAGACGCGCCGAGTCATGGCACGTCAATCAGGAAATTGACCATTCGTCAATTCTTCACGTT
GGGAGAAAGAAAACTCGAGCTCATTCCGCAATGAGCTCGCCTCAGAAGAAGACCGACGCTGCAGCAGAGGGGAAGTCCTCCGCCGGGATAGAGACTCTCT
CTATCCCCGAGTACCGCGAGCGTCTCAAAGCAAAGCGAGACGCTCTTGCTACCAAGGCTGCGGCGGGGACAACTCAACCAGAGATTGTCCTCGAAGGTTC
TTCTGTAGTCAACGACGCCGTTGACTTCGAAGACGACGACGTGGAGATGGAAGAGGGCCAGGCCTCTTCTAGCAAGCGCAAGGAGTCTATCGACAGCGAT
AGTCTCGACCCGCATGCCGGGTCGAGACGCCCTCGTGAAGGAGACGACTCGGATGCTTCGAGCTCGAAGCGTTCGCGCGGCGAGAGCGACACTCCGCTCT
CTGCTGCTGGGGCTTTAAGCTCCCCGCGTGAGGTGGCGCCTTCAAGCTCTCCGCGCGCTACCTTAGCAGCGCGCGATCCGTGGATGCCGTCTGCGTCAGA
GATCGCAGACCGTGTGTGCAACACTGTGCCTCCAAACGAAATCCCGCTGTACGTATGCAGCGGTATCCACGACGATGCTGTTGCGGAGGAGCAGCACTTT
GATCCGTTAACGAATCAAAGGCGCGATTATTACATCGGGCTCTTCCACGAGCTCCGATACTTCTCCAGCAAGAAGATTTCTTCTCGCAGCAGAGTGCCTG
AATGGCAGGCACTTTGTCAAAGTTGGAACGCTTTTGTTGGGAACTTCAACAAGAAGCCGGCTGCTTACCGCGAGCGGGTTAAGCAAGCCCGTGAACGCTT
CGAGACATTCTCGACGCGCGGGCGGCTGGAGCAGCTCCACAGATCCTCTGTGGACGCTGGTATTCCATGTGCTGTGCCCGAAGGCCAACAGTGCACGTTG
TGTCTTCCGGGTGCGGCGCGCTTGAGCGACCGCGACCTAAACGGGTACACGACGATTCGTGTACCTGCGAGTCTCAAGGATCTCCGTGCCAAGTTCTTGG
CACATGAGGAACGCGACGATCGTGGGACCTCGGGCGCTGTAGGTGACCACAGCGCTCGCACTACCTTCGCGTCGGCAGAGCGTGGTGAGCTTCGTACGCC
CTCACCATTTCCGGAACGTCCTGCAGCAGGACGTCCCGTGGCTCCCATGTATCTTGGTGGGGCGGAAACCCTCTCCAACGAATACGATAACGAACCGG