Description :
From Genome Similarity Track
Location :
Scaffold_893:3- 1528
Transcript NameFunction/comments
g13942.t1XP_002908098.1 helitron helicase-like protein [Phytophthora infestans T30-4

Sequence
1525 bases(100 bases per row)
GTCGACACGCTCGATCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTTTATTTTTTTGATTGCCCGTGACGATACCCAGTATCGCCACGACGGC
TCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCGTAGTGACCGATGTTTCCGCATCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGA
ACTAGCAGCGGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTACCACCGGTCGTGGCATCAGCCGCGGGACGTTCACATGCAGTTTA
GCCTGCCGCAGGCTAAACGCTTCTTGCATTGCAAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTTACAGGCCCATCTC
TAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACTGTGCTCTTTGGGCGTAAGCATGCAC
GTCATGCTTGCCCGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTCTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCTTCGT
ACGTGCTAAAGCACGTAGGATCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTTGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGG
GTCGACGAGACGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTACCAACGTAGCTGCTTACGTGGAGTTTT
AATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCT
CTGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGG
GCAGTCTGCACGCGCAACATGCGTTGCAGACATGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATA
CGAACGTGTTAGTCGGTCGTTGGACGGACTAGAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTA
GGAGGAAGCGTAGGAGTAAGTTACTTAAGTTCAGTATACTTGTATCCACAAGTATACTTAAACCTAGATAAACGAACCAAACGAAAGCTTTGGTGGTAAA
TGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAA
TGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGTGGTCACCTGAATGTGTGCCTTAGT
GCATGTTGCACTAAGGTAGGAGGTG