Description :
From Genome Similarity Track
Location :
Scaffold_4108:3- 1520
Sequence
1517 bases(100 bases per row)
ACCCATGTACCAAGTAAAATGGTGTATCACCCCGGATCTCTGTCTTGGGCGGTGTTCATCGCGAAGGGGAGCCGTTCTGCGTACTCATCCCAATCCCTTT
GATCCAAATCCTGGACATACATCTTGAGTGCTCTCGTGATCGTCTGCACCATGCGTTCGGCCGACCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCG
CTGTCGCTGCCCTAGGATCCGGTTGAATGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATCTCGCTAGCTCCAAATCTTCGG
AAAACACACTCCTCGTACGATTCAGCAATGGTTTGCGCAGTTCTAGATGCACTAGCTTTGGCTACCACGTATCCAGTAAACAGGTCCACCCAAATCAACA
ATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATATCCAGGTGACTCCCCTT
CGATTGTGGGTCTGCCCTTGCCTGTCTCACAATCCACACATTTCCCGACATACCGTTGTACGCTCTTGAATAGTCCCCTCCAGTGACAACATTCCCGGAT
CCGTTGGTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAAGCTAGCGTGATAGTGGTGTAGGACATCCTGTTGTAAGGTTTCCGGCATCACAAATCTC
ATCAATCCATCCCGATCCTCGTTAACTCTCTTCGTAGGGGGGAATAGAAGAGCAAGTCTTTCAGATCCACCGCGTAATCCGTAGCGATAATGCTGTAGGA
TTTGGCATCTTCCCGACTCAGGTCTCGTACATCCGCCATCAGATACGTCTTTAGTCCTAGGACCCACGCTTCCTCGTTCTGTGCTTTGAGGATCCGCTCG
ATGCGGACTCTCTTCACAAATGTTTCCTGATGTTCGGCCTCTCTCTCCACTTCAACACCACATTGATTCCGTAAAGCGGCGCTGGCCAAGCTATCTGCAC
TGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTT
GCAGTCAATCTCACCTCGCACCTGTCTGATCACCAAGTTTGAATCCCCACAAATCACCAGCTTTTCGGATCTTGTCCCTTTAGTAGATCCAAACCCAGCA
GGAGCCCGTTATACTCCGCTTCATTGACGGTGAGACCCTCCGCATAAGTGGATCTAGCCCGTACAACTTCCCATCCTTGCAGTCTCCACAGTATTGCACT
GTACGCCCCGCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCATCTGCCTGTACCGTCGGGATCGGGATCTGGATCCGG
CGTTTGCGCTCTTTCTTAGGAGTGACTCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCTC
CTTTCGAACATTTCACA