Description :
From Genome Similarity Track
Location :
Scaffold_3312:3- 1516
Sequence
1513 bases(100 bases per row)
CGAGTGTTATATAGATACGCTTGCTGTAGTTGGTGCAGTGATGGAGTCGATCCAGATGTGTGGATGTGAAGCGTATACGTACGACGGAGACGCGATCAAG
ATCACGCTGGCAGGTGTTTGTGTATGGTTGACATTGGTCGGGGATCTCGCTGTCAGACGCCATCCTTGGGATGGATTTCATGTGCCAGCCGGAGTGAGGT
TGGATCTGGCGGATGGACACTTGTTTCCCGAGAGAGCGATCCACTCACGACGCGGCGTGTAGGGCTAATGAGATCTAGGGGGTAAGAGACCGATTGCGAA
CGCGAGAAAACTCGGGAATCTGCCAGATGCGTTAGAATGAGGTGGAACTGGGAAAATGTGGTTCATCTGCGAGGGAGAAATAGTGTGCTTAGCGTATTCC
AGGGAACCAGTTGAGATCACATAACTTCCAGTTTCACGAGGGTCAGGGACAGCGACACCAAGAGAATTTTTACTGGACCATTATGAGGAGATCGGGCGAT
GGTTGGCGAAGGACGGTATCCCTAGGCGACCTGGATATGTGTCAGTGGGATCCCGCCGCTACAAAGAATGGCAGAATTTGGTGTACGAGGCGACTACCGA
GATCGAATCTCTCGGAGAGGTGGAGCTCCCGGCGGGGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGAAAT
CGTCGGATCGAGATCCAAGCGATGAAGGTTGGATCCACGACGGGGGATGATCCCCAGAGTCGTCCCCCAGATAACGCAGGATCGGTGGATGAAGAATCGC
AGAGGGCTGAAGCCGGACCGCCAGATCCCGCTGACCCCAGAGTGGATCATAACTCCTAATGGGGCCAAGTGTCTGGATCTTTGTCGACAGTGGCCGCACT
AGCTAAACAGGAACCATCGTGGGTAAGCCCACCAGAGGATCAAGCCGATCCAAAAGGTGGCTTCCCCAGTACCAGGATACCCGACCCCACGAAGCCAGAA
GGGATGACGGTTGAAGGAGAGTCGCAATGCTTGGATCCAAGGGTGGATCCGACAAAGACTGAAGATGAACAAGTCTGCTACCGTGAAGGCGGGGATCTAC
ACGCAGAGGATCTTGGGGAAGGCATGGCGGTGATCCCGGAGGTACCACGGACCACAGAGGAGGTCACGATTGATGATATCCAAGTGGATCCAGGGGCGAA
CGAACCCAAGGAAGTGGATCGTCTACGTCAGAAGATCTGGGAAAGTCGACATCTGCTGATCGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTC
AAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAAAGGGTGCGGAAGGTGGCACCTCAGTTCCGAGAAAAACTGTCGGATCTGATTAAGGGCC
TGCTGCAAGCCAAGATCATCAGCTTCTCAACGTCCCCGTGGGCATCTCCGGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGA
TTACCGGCTATCT