Description :
From Genome Similarity Track
Location :
Scaffold_2908:3- 1352
Transcript NameFunction/comments
Phypl_g15480Major Facilitator Superfamily (MFS)

Sequence
1349 bases(100 bases per row)
AGGCCTCGAGCATGGCGATCCCCACGGACGAGTACACGATCCACGTCGGACGTAGGGATCGCTCTTGGATAGTTTGCATGGGATCCACTTCAGACTGCGT
TGTGGGCGTCACCACCACTCGGTAGTCGTTTCTAGGGGAGACCGACATCTTGACGCTGGAACTGGAGACTGCAGCGAAGGCGGTGATGAACGAGAAGCAA
CGTCCGCTCGATGAAGCGGAATCGGAAGTGATAGCGGATACCTCGCTCGAGTCCAAGTTGGCGCTTCACCTCGCGCTTGCCACTGGCAATGCCATGGGCA
TGGCTGCTGAGAGGGGGGGCTCGCGACGGTCCCAACGTCCTCGGTGTTTTTGTGGCCGCCTTTTTCTCGTGTGGGGGCTTCCTGGGAAGACTTGCCGCCA
AATGAGCCGAGACCACGCACGAGGTGCCAATGCCCATCTCCGATTTGCTGGTCGCGCATAGTGGGACCCGTCAGTATGTCGCTAGGGTAGGGGATACGAC
CGTTGGTTCATAGGGAATTTGTATGGTCGGTCGGATTGAGCATCCATCACCACCTTGGTTGGTGGCACCAAGCGCCCGTACACGTTGCTGTGTCGTGGGA
ACGAGGGCAAAATGGAGGGTACAAGCGAGCTGTTGGGCTCCTCATTGGCTGAGCATGCGGGGTCGTGCGCCAGCGCAGATTTTGCGGTGGTTCGAGTTCG
AGAGCGATTAACTCGAGGCTGGACTAGAGCAGAGCCGCTCGTTCCGCAGCCATTTCAATAGAAAGGCCCTCAGGGCGCTCCAGGGACTGATCTCCATCCT
AGGTTCAACCGTGCAGCGACCTTGAGTATCTCTCGAGGATCTCGACTGACTGGGGGGTTAGAGCTATAATAGTATTGGCTGGGCGAGCAATCGTTGGGCG
GATACCGTGCGTCCCGCCTGCAATgcaggtacatgtacgtaaGTACAGCACGGCATTTACTGCATGATGGGGAGACATGTGACGCCGTGAGCAATCGATG
CGTACAGTTCAACAACATCATACATTCCTTTCTCTTCCTTACACCTGACTCTTGCTAGACGACTGCACGCTGTGATCGCTGCGGAAGCCGTCCTGGATCT
CGGCAATGGTCATGTCCGACGTCTCCGGCACCATAAAGTAGATGAAGGCGATGGAGAGGACGGTCGTGCCGAGGAACGGCGTGAAGCTGTAGTTCGTGAT
GGCCTCCTCGACGTACGGGAAGCCGATGCCCACGATGAGCGAGCAGATCCACTTCATCGTGAGGCAGATgccgacggcagctccacgggcCGAATCCGCG
AAGAGCTCAGCGACGATGGGCCAGAGCAGCGGGCCAATACTCAGATCGT