Description :
From Genome Similarity Track
Location :
scaffold_293:3- 1337
Transcript NameFunction/comments
Pl_106476transposase

Sequence
1334 bases(100 bases per row)
CTCAAATCTCCACACAAGCTGCCGAGTTATCACGTGCTTGCTCGTTTCGACAGCATCTGCCAGAATAGCCATCCGCTGCGCCGTATACGTCTCGTATTCA
CCACGAACCATCATCTCATGTTTCCTTTCAGCTAGGTAGTGCTTCATTTTGCCTTTAGCGAATTCCAGCAACCCTCAATGGGGTTCAACATAGGACTGTA
AAAACCAAGGCGTAGTATAGCAAGCCTGTTCAGGTTCACGATGCCATCCTCCGCAAGAACTTTGAAAGCCAGCTCTTCGATGCCACTGTGGGCAGGGGCG
TTATCCGTCACTATGACAACCTTCTTGGAGCTGTCAAGCTCTCGATACTCTTCAGAGCGGAGTGCAGCCAAGAGCAGCTCAGCGATAAATCGAGCATTCT
CTTCCTTCTTGATGGATCCTTCGTGGGTTTTTAACAGCAGCAGCCCTGCTCCCGACGACACACCTCCTTGCACATGCAGGTTTATGCCCTTCGACGGAGG
CAAGGCAACAGTAGCACGATCGCCAACACGAGACCTGCCCTCAGATCTCGACAAGTACAGATTAAAATTAGTCTCGTCATGAAATATAATCATATTATCG
TTGTCAATATGCGGGTTGAGTGCGTCAACAAAATCCTTGCGTTTGGTCTTGTTATCTATCGAGTTCATGGTGGTTTTCTCGATACGAAGCTTCTTGATTG
AGTATAGCATGCCTTGAAGTGCACGGTGCACCGATGGCATGCTCACAGACACGCCCATTTCTGAAAGTAGACGGTCACAAATTTGTACCAGGGTCATTCG
GCAATCTTCATCAATGTACTACTCAATCTTGCACATTATATTCACAGGCATCTTGATTGTGGTTCTCCGCAGCCCTCCATGCATTCTATCCCCTCACAGT
TGGCGATAATGTCACGTCGAGCAGTGTGATACTCTACGTCGTTGGCGTTGGCAACAGCACGCCAATTACCGCCCTCTTCAAACGCACGCACGACACGTGC
CTTGGCCTGAGCGCGTTTGAAAGCTGTCGCTGCTCGATTAACTTTGTCGGGGATCGGTTGTGAAGGCATCACGGGGAAGAATAGAGAATGCTTGATTAGG
AGGCAGCAGGAGCTCTGAGCTGGAGAAGATCACAGCCACTGCTCTAAGCGCGCAATTTCGCGCCAAAGTGATTGGCTTTGCAAGTCTTGGGAAAGTTCAG
CGCGCATTTTGCAAGTCTTGGGAAATCATCATCTTTGTACACCCCAAAATAGTGCCGACCTTTTTGCGCACATGTTTAAAACGTATTGTTCGTCTTGCTT
GGGAAACTTTGCAACTTGGGTGACAAATGGTGTA