Description :
From Genome Similarity Track
Location :
Scaffold_3891:3- 1300
Transcript NameFunction/comments
Phyta_totarag15532reverse transcriptase

Sequence
1297 bases(100 bases per row)
CAGCAGCTTTGAGCTGCCGTGACTGAAAGGAGGCTACCCGCTCCCTGCCTTCAGCATCAACCTGTAACAGGGCACGGCCTATGGCAAAGTCCGACGCGGC
GCACACGACGCTACAAGGACGGTCATCGTCTGGCAAAGCCAATACAGGCGCACTTTGCAGGCTACGTTTGATGTCCTTAAAGGATTGCCGAGTCTTGTTG
TTCCACGGCCATGGTGCATTTTTCTGAGGAGGTTCGTAAGTGGCCGGGCCATCTCTGCGTAGTTGGCGCTGTACTTGTGCATGTATTTGGCCAGGCCAAG
CCACTTGTGCAAGTCCTTCTGGGATGTTGGCACTGGTCATTGTGCGATCGCGCACACCTTCTCCGAGTCAGCGCGAACACCATCCTTGCCAAGGAAGCAG
CCCAAAAACGGGATCTCTTCAGCACCGAAGATGCACTTGTTGATGTTCGCATACAAGCGATTCTTTCGCATGCCCATCCAAACCTCCCGGAGGTGCTCAA
TGTGCATCTCGATGGccgtcttgccgtcctcgGCGCGACTGAGcacgaagatgtcgtcgaagtacATCTGTACATACTGCCGCATCGGCTGAGAGAGCTG
AGTCACCAACCTATTGAACGTTGCTGGTGCGTTCGACAGCCCTTGGGGCATAGCTAGCAACTCCCACAGCATCCTACTGGGAGTGCTCACCGCTGTGAGA
GGGATATCCGACTCGCGCATCAACAACTGGTAATAGCTGTCGGCCATGTCGAGTGCGCTGAAGAAGGTACAACCCACCATGTTGTTTGGCAACACGTCCT
TCCGCAGGAttggcgtcgacgtcggGATTGTAGCtgcgttcagcttgttgaaAGCATGCACCATGCGCCACTTCCCGTTGGGCTTTCGCACACAGATCGT
CGGCGACGAGTGTGACGACTTTGATTCGCGCACCATGCCCGCGGCATATttggcggcgaagaaggtgtCGATCACATGGGCTTGCTACTTCGGTAACAGC
CATTGGCGTGTGGTGCAGTACTTGGTACCGGGTGCCAGATCGATCTCGTGTCGGACGCCCCGATCCGGGTGGTAACACCGACGGTGGGTTATCATAAACT
ACGTCAGGGAATTCCTTCAAAAGGGAATGATACGGATCCGAGGGGTCCTTCTGGACCACAGCGCCATAGCGCCTGTGTCTCTGCGAAGACCACTCGACTT
CTAGCACGTCGGAGTCCATGACCGAAGAGGTGTTGAATTCCACTGAGTCGTGTTCACGACGAATGAGTACCAACTCCTCAAGCTCGCCCGCCTTCAG