Description :
From Genome Similarity Track
Location :
Scaffold_1995:3- 1256
Transcript NameFunction/comments
Phyta_totarag13972hypothetical protein

Sequence
1253 bases(100 bases per row)
TTGTTGTCGCCGGCGGATTGTATCCGCGGGCGCGCGTCATCAAGCCCGGCTTGATGCGCAAttggttcttcttcgtgcagcccgGCTGCACGAGAGCCTG
CAAGCTTTCCCAATGCTGGACGTTTGCAACCGTACGCAGTGCTCACAGCGTCAACTCCCGGTGCTGATGTGCCTTCGTCGCATCGACGCCTTTCGTCGGA
ATGTCCTGCCGAGTCTGATCTAATCAGACTTGCGTCAGCTCCGAGAGTGGACTCGTCGACATCACAGTGTTCCTTTGTGGCGGATTCATCCTTTAAATCT
GTGTTGCTTCCCAGAACCGACACACATTCACTTCCAACGCCTTTCGAAGTCGTCGCAGTTTTCCTCATTCGAGCCCTGCGCGTCGAGACAGCAGCGTTCA
GCGCTGTCTCCAGTGGAAGGTCACGCACCTCGCGGTGCATGTGTTGCGCTGACAGGGCCATCGCTTGCTGTCGCAACCGAAGNGTCGAACAAAGCTGTTC
GACGCACCGGAATCTACCAACGCACGAAGAGAGTCCGCTCTCTTCGACgtcacgtccaggatgacaaGGTTTGGCTTGTCATCTCGCTTCTTGCAGTGAG
ATTGTCTCTCACTGGGGGATGCGGCCTGCAATAACGCGTGTCCAATTCGACACGCGTGACCACTTCACCAGTTGGACACCCCGCACCTACTGCTTCCACG
TGTTTTTTTGTTGATCGCAGCGATACCCGACATCGCGATGTTGGCCTCTTTGCTCGTGCATAGGTGCTGTCCACTCGCGTGCAAAATGACCGATGCGTCC
ACAGCGGATGTATCGTACGTCAGCTCCACGATGCTGTGGGTGACTGACAGTCGTCGAATTCGAGAGGTCCATTAGCTCCAGACCTCCCGTGAGTACCACC
GGACGTGGCATCCTTGGTACATTCACATGCAGTTTAGCCTGTCGCAGGCTAAACACTTCCTGCCTTGCGAACGTGATCGCAGCTTCGAGGGTATTCGGGT
ACTCTCGGAAGAGATAAGTCTTCACTCGTATCCTTCAAGCccttcatgaacgtgacgatCTTGATCGCCTTGTCAATTGGGTTGGTCACGATGTTCGAGA
CCAAGTACCGTGCTCTGTGGGCGTAAGTGTGAACGTCCTGCTTACCCTGTTGCAGATCTAGGAGCTCTGCCCTCAATCGGAGCTTGCTTTGAGGACGTTT
AAATGCTCGCCTGAGCTCCTCTTTAAAAACTTCGTACGAGCTGAAGCACGTag