Description :
From Genome Similarity Track
Location :
Scaffold_2299:3- 1247
Sequence
1244 bases(100 bases per row)
GAGCAGTACGAGGAAGGTGACGATGGATTGCTGTACTTCGTTGGACGATCCCATCGCAAGCACGCTGAAGGGCGCGAGATCCAGCTGCGTCTGGTCGCGC
CAACCACAATCCACGATGAGATTCTGCATCACTACCACGCGAGTCTGACCGGCGGGCACCAAGGGATCTCCCGCACTTACGAGAAGGTCAAGCGACACTT
CCACTGGAGAGGGATCCACAAGTCAGTACAGAAGTACGTCGGATCGTGCATCGATTGTGAAACCGGCAAAGGTCAACCTCGGATCCGCAGTCAGTCTCCC
GGGAACATCGTAGCGAAGCGACCATTCCAGGTTCTCGGTATGGATCACATACCGTCGCTACCGGAAACCTACCGTGGCAACACCGAGCTGCTCTTGTGGA
TCGACCAGCACTCAGGCTATGTGATCGCGTCGGCCAACCCAAACCGTGAAGCCCAGACCGTCGCCGAGTCATACGAACGTTGTGTATTCCGTCGCTTCGG
TGCGAGTGAGGTGATCAGACATGATCGCGAACCGAGTTTCATGTCGGAGGTATTCAAGGCCTTCAACCGGCTGATCGGGCAACAGAGTCGTGCAACTCTT
GCCTATCGGCCACAAGCCAATGGGATGACAGAACGCATGGTAGGCACGATCACGCGAGCAATCAAGATGTTCGTTCAGGACAAGGATCAGAAGGACTGGG
ATGAGTTCGCTGAGCGCCTCGTGTTTGCGCTGAATACTGCCTACGACCGCACAAGGGAAGAGACACCACACTATCTCGTACACGGCTGGGATCCACGAAC
TACGCTGGAGGTGGCTACACCAAGAGCGGATCCAGGGATCTCAGCTAGTAACCCGAAGGTCTGGCGCAACATGGTTCAGCGTGATTACACTTACGCACGC
GCAGCGGCCAATCAATTGTTGGAGGCAGCTATGCGGACTCGAGCGGCCGAGGCCAATAAGATCGCGACTGGAGGCGACGAGATCGTTGTCGGATCACAGG
TGTGGCTATTCTTTAATCGTACCAAGCCTGGTTACGCTCGCAAGCTCGCGCATCTATGGCATGGACCTTTCAGAGTGGCTGATCGGCTCGGGAACTACCT
ACTGAGACTCGAGATCCAAGGTTCAGAGTATCAGTTCTTCCCTATCGTCCATGTTAATCGCGTGAAAGCTCGACGCACCTATGCGGAGCGACCGGACGCC
GAACTCGTGACAGATGGCGAGCGCTTTGATTTTGACGAAGCCCT