Description :
From Genome Similarity Track
Location :
Scaffold_891:3- 12239
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_891-snap-gene-0.0Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_891-snap-gene-0.1Conserved gene of unknown function
Pytul_var.sporangiiferumsnap_masked-pug3_contig_891-abinit-gene-0.3C2 domain containing protein

Sequence
12236 bases(100 bases per row)
TGATCTGTGCCGCCGCTTGCATCACTAACAACTCATCGAGTAAAGGCTGAAGATTTGCCCACCTCTTGTTGACCTCGACGACAGCCGTACGGTACTTGTC
AATTTTATCAGCTAGACACTGTAGTTGGTCACCTTCCTCATCAGAACCCTCCATCGGCGAAATCGCTTTCGTATGAGAAGCAAAGATGTCCCATACTAGG
CTCAAAAGAATCGGTGTACGCTCCCAATGTAGTTTGCCTGATGCTTGCGCGGTCAGCTCTTCAAGATACCCCTTCATTGTCATCCAACGACGGCGTTGCG
CGGGGACGACTGCTTCATTGATGCGACAACGAGACGACTCGTGCTGGGTGATGAACTTTTGCTTGAGTACCTTGTACACATGTGTAGCTTCTTCCAGCAA
TGCGCTTTGTGAATACGTCAGTTTTATGCGAAGGTAAACTTGTCCGCTGTATGTCAAGCCAGCTTTGCCAGCATTTGGTTTTGTGCCCGTGGGTTGATAA
TCTCCTCCCACACCGTACGTTGCGCCAGGGTTGGAAAAGTTGCCAATAATGTTTTTTAGCATCACTCCGTACGCATTGGGTCCTTTGTGCGGTTTCGTTA
AGTGGTAAACATTGTAGTGCTCTTCTTGGTCGAGCAGGTCGATCAAAGGAATTTGTGCTACACCAATGAGGTCGTTACCGATACCTGGATCTTGATCCAT
CACTTTGATGCGGAGCGTTGTACACATGATATCTTCCAGCACTTGATACATTCTCATCAGTCGCAGTCGCTGGTACACCCGCCGATACACGGTTTGGTCT
TCTTCATCCAAATCTTCCACTTCCTCCTCAAAAAAACTCAGCACTTGCTCACCGTCGGATACATTAATGTTGTCTCCCATTGCGTCCAGTTCATGCAATC
TCTGCAGGGTTGGAATCAGCCGACGGCAAAACATATTATAGAGTTTCAAGATTGTTCGGCGCAGACGGAGCGTTGACGTCGTGATGTTGGCATGCATCAC
AACGAGGTCATCACTACTTGACTTCTTCTCATCATGGACAAGATCCGAGGACCATGGCAAGCGTCTCCCGACCGTTTTGATGCCAAGCTCGGTTGCTGTA
TCCTCCAAGATCCACTTGGTTTGCGCAAAAGCTTGCTTTATCTGGTCCATTGCCCGTGGTGATCGCAGGTTGTTTTCGCGCCTCATTTCAAGCCGAAGTG
CGTTTTGTGACGACGAAGTTGTTTTTGTGGCATAAAGTTTCTCCATTGCATGCGATATCAGCATCACGTTGGCAACTTTTTGAAGCTGTAGCTCTTGCTC
CTTAGGATCTGAGAGCTTAATCCGACCGCCACCAGATATGATGGGACCAGCCGCCAGTAATCCACGGGTCAGTTTATTGTCATGAAGCTCCAGCGTCGAG
ACGAGCAGCTCGTATGGATCAATTTGCCACGCATCTTGCTCTTTCTTAAACCTCTTTGCCTGCACTTTTTGCCCTTTCGAAACGCGTTGCGTGCGATCAA
TTTCAAGAGTAATTTTGCCAACGACAACCTTGTAACCATGCTCTTCGCGCTCGATGCTAAAATCCTTGGTGGTAGCACTATCACTCGCTGAAGGGCTTTC
GGAATGTTTTCGGTACTCGCTTTCAGCCCACGCAGAAGTTTGGTGGATTTGATTCATGGAAATGAACGCGGTGCCGAAAGGAGCTGTTTTGCTCCCTTTA
TCCATCAAATTGATCCTCACCCCAGAGACGCGCTGTAAATCTACCGCAGGGTATCCAAAAAATAGTTCTTTCGGTTTCTCAACAGCTTGCGTCCAAGCAC
CAGTCTTCACCTGCCGTGACAATTGTATTGAGGACGATTCAGGGTACTTTCCACCTAGGAGATCAACGCAGATCTCTCCTTTCAAAGTCAGAGCCACACC
AAGTGGAGTCACCAGGGCCTGGTCGCTAGGCTTTTGGCACTTGAAATCCTTGGAAACAAGCATCACTTGGGCAATAATATTATTGTTGCCAATGCCCCTC
ATTTCGCCAACTTGCACAACGCGAATACGCATTGTGTCAAACTTGAGATCGTCTTGGAATACTATCCCCTTGGCAGGTTCTTTGGTGCTTGAACTGACGT
ACTCGATTTCATAATATGGAGAAACCTCCACGTTATGATTGTTTTCATGACTCACGCTCTTGAATCCTCGAATAGACTTGCGAATCTGCTGTCTCTTTGG
ATGATCGGCAGAGATGAAGAGCGGACCTTCTGTCACGGTGGCCTCTGAAAAAGGAGTCATCCGTCGCCGCAGTCGTGCGTCGCCCACAATTTTTTCGGCT
GGTAAGCAAATCTCATGAATCGCTCCGTTCACATCCGTTGCGCAAAAACGAACATCGTCTAAAGGAACAAGTTCCAATGACAAAGACGGCTGTGATCCCT
TTTCAGCGTACCAGTTCATTGCTTCGATGTTCACCGTCTGCGCCAAATAATTGGGTAACTCGGTAGATTCTCCAGCCTTTTCAAGACTCCAGATGCCCTC
TCCGGCAGCAACTGCTTCCGAAATAGAAGAATGCGAACTGAAATCTGTGAGTACAAGCGAATCACACGATGCCAGGTGATCATTAATCAGCTTTCCATCT
TGAAGCGCCACAGTTATAGCTTCGGCGATACTCCCTTTGTTGTTGTGCGGAATCGCAAGCTGGAAGTGGAACTGGATGCTCACACGTTTCAGAGGAATAC
GATCGCGCTTGGTAGCTAGGCCGCCATGAAGGACTACCTCGCCGTCACACGTTGACCCTATCGAGTTCAAGACTACATTTTGCGCTGGTTTTCGATCAAA
ACAGATTTCCATGCGTTCGATCAACAGAATACGTTCTCTCCTGTTCAAAGGTAGATCGATACTCGCAGTAGATCGCAGAATCTTTTGAAACATGGCCATA
AACTTTGCCGGGCGTTCGAGAGCAAGCGCTAGAAGCGCTTTGAATACGGCAACCGAAGCCGCAGTCGAGCTCAATCGGAAAGATCCATGAATTTCAGCTC
GAGGTTCGGGAGCTAAGATCAAACACACACATCTATCGATGGCAAACTCATCCGCGATCGAGCTGCTTCCACTGTTGTGGCTGTCGTGTTGCCGCTGTTT
AGCCAACGCATTATGTATCTGCGAGAGTTTCATTTCTTCCACTTTGCTCAGATTGTTGCCTTTGATGTACCCATGACACTGACCAATAAACCGAGGTTTT
GCTTCATTCCGTTCGCCCACTTCAGATTGCAACAGCTTGTTGGTTGTGCTATCCCGTAGCTGAATGCTGGCGACTGGGTTTGGAAGCATGACGTAGACCT
TGGTAATTTGATCGTTTCCCCACAAATCATAGAGTCTTGTTGCCATAGCACCCGCTGCTGCCTTTCCGTTCGGATCGTGAACTGCTAGCTGCGATTGAAA
TACCGAGACCAGAAAATACTGATCAGTTGGGAATTTCTCATCTTTAAGGCGAAGTTGTTCCCTTGCAATTCCTTCAACAAGTGCACCGTTACTGAGCAAG
ACGTCGTAGTTTACAATCAGGCAAGAAGCGTTATTGGACGGGACAAGGAATGCTTGCTTCACCTCGCCGTCATACATCATGCGTTCAGATAAAGGTTGAA
TGCGATCGCGGTCGACACACGTCACAGCGTCATCGTCTAGCTTTCCTCCGTCCAAAAACTCAACATTATATCGAGCGTTACCGAAGTTTTTCATAATTCT
TGCTGGCCGCGACTTACTGCGAGCGACATTCAATCCAGTGGTCTCGTTTTGAGGCACTTCGGCAGCAGCTTCAGTGACAAAGACCAAATCATCCTTTGCC
AACTGTCGATGCAAATTGTCTCCCACAACGCGATAATGCATAGAATCAAGAAAAGCTCGTGCAAGCCACTCCGTTTTGGGTTCTTCGCCATCCGAATATT
TGACCAAGTACGGGCACTTCGCATGCTCCACATCATCTTTCTTGGTGATTATTCCGACCCGACCCTTTTTCACGGAATGATTGTGAGTGTCATCGCCACC
GGGGCCAGTCTCTGCTTTCGCAAACTGACAAACAGAGACAGTTTGGTCAATGATCAGCGGAGGGAGCTCTTCATCGTCCGAAAAATACTCGTCGCTTTCA
TCGCGTACTTTGGCAGCCGCGCAGAACGCAACATCGCATGACCCATCGCCATACTCTCGAATGATGGTACCCGCCACATAGCGGCCAGTCCGCAACCGCA
CATCAACAGCGACCCCAGAATGCTTGCACACGTCAATATAGGCGTGAACGCGATCGCCCGGTCGAAATAAAATTTCCATCTGCGTGTCCTGCTCACCAGC
GACTTCTCCTTTGCCTAGTTGCCTAGTTTCAGCACTAGTACTCTGTAGGGAAGCAAACTCAAAGCCTGTCCAGTCACACTTTGTGAATACCGCATGAACA
AGTTCTGGAGTCTCTTGGCCGTGCAAATGCCCAATCAGTTGAGACTTGGCTTCACTGACGTGAGTTACAATCTGTGACCATCGAGACAGCACGATGTCCA
ACGCAGCAGCATCACGAAAAGACAACAAATCCTTCTCACCACGAATGAAAACATGCTCGTAGATGCAACTGAGCAGTTGCGGGGTGAACCGCCAATGCAG
CTTTGTCGACCGACTCATGCGGTGCACTTGAGCCATCAACTCTTGCGAAATGTTTTTGCTAGGAAACATGTTCACTCTGAACACTTCCCACAAAAAGTTT
TGCAAGTAACTCGACGTATGCAGCTGATTGTTGTTTACAGTATGATGGTTCATCGTCTTAGCATCAAACGGTAATCCCACGACACGGAAAGTTTCAGCTA
AAACACGTTTAAGTCGCTCGGCGCGGTGGATCCCAACCAATGTGATGTCGACTAGCATTTGTAGCTCGACATCTTTGTTGTCCTTGTCTTTCAGCACGAT
AGCTTCATTTTCGAAAGATGTACGCAAATCTGGGCGTTTCCAGATCTCAGCCTTCTCAAATTTGCCCTGGAATGTCTTTCCAAGCACATCTGACGAAACA
ATCACATCAAAATACGACACTTTTGACACGTCGTACGTCCGACCCAGAAATTTGCACGATCCAAACTGACTCGTTGACGAATCAGTATCGCCAGAGTTAG
TTGACGATGCATTACCGAGCTGAAGCAGGTCGCTAAGCCGATGCTTATTGCCTTGAGTGAAATCTTCAAAGTGAGAATCGTAGAGAATACGATGACCTCC
CTCTCCGTGCGGTTGAAAGACGCAGGTGTATTGTCTCCAGTCGAAGGCCTCGGCTTCTACAAGTTTCATCGCTGCCGAGTTTGCACAGCCAATACGTTTC
ACTTTCACTTCTGCTGAGAACTTTGTATCAGGGTGCTTCTGCGCCGCCATCTTAGATGGGCTAGGCAAAGTACTTTGGTTTACAAAGTTCTCGTTCTTGA
TCAGCTCAATTCCGAAACGCAGCTTGCCAAGCCGACCATCTAGTTCTGCGTCGTTTCCTTTCGCCTTTGCTGATTTATCTTGTCGCGCTTTTTCGTCGCT
GAGAAGCATTGCTTCTACTTCAACCTGGTTCTTATCATCCAGGTTCAATGCCTGACGCGTTGGATTGCCTTTCGCATCAGCATGAATAAGAACAAAGCCA
ATAATGAAGCCAGATTTATCCCGTTGAAACTCCAGCTTTACACATCCAAGAGAAAACTCACGCATACTCTCTTCATCCAAGACTCGCAATAAAACAGCTT
TTTTGTCACTGAGCACAGTGGCTTCTGTTTTCCCAAGCACGAACTCTTGGTTTTGCCACTTGGGGTTGACCGTCTTTGGCTTCACGTCAGACTTGAGTCG
TGTGTATTCTTCTTTTCCGTTCTTTTCATGCAGCAAAACGATTTTCACGAACGGATTTCTTTGTCTGACATCACTAGGGACCAGCTTCCTCGCCTCATGA
ATCGAAATCTTTAGGAAAGATTGCTCACGAGAGTTTACTGAGCTGCCTCCACTTGGTAGTCGAGCACTCCGCTTATTTGTGAAAAACGATAGCGAGCTTG
ATATGTATGGTTGTAGAAGCTGATGTTTCGCAATTGCATCTTTTAGCTCTTCGAGAAGCGCTGGTCTTGTCTCGCTTCGCACTAACTCGTTCACGTGCGT
TAGGCGAAGTTGAACGCGCAATTGACCTAAATGCATTTTTTGGACCATTTCGCTCTCGGGTGCTAGAGGATACCAAACATCAGACACACGGTGGGGCGAA
ACCATCTTGATTGGAATCTTCAAGCATCCCAGAGGTTTCCTTCCATTACAGTTGATCGTCATTCGAGTGACACAGTCTTCCAGGTCTTTTGGCTTGAACA
GCAAATTCGAATCGATGCAGCGCTCTTCGACTTTCGCAGCATCAAGATCTCCGTTTGTGGCTCTGAAATGCTCGCGCAGCATGCCTTCTTCGATAATAAT
CTCGTGGGAATGGCGATACTCGATGTCATACAACAAAAACACATCACGTAGAGTCGTGGGCAATTTTAACCACGAGGCCTTGTCCTTCACTTTATACTTG
AGTAGCAACTGCTCGACTTCTGGCGGCACTTCATTTTTGTCGTTTCGGTCGTACAGTGTAGCAACGTGATATTTTGAATCGGTATAAGGAGTTCGAATGC
GAATGATCCGACCAGAGTACAAGGCGCCAGGCGTAAAACTCCGCGAATCGGTCGGCTTTGGATTCAGCTTTTTGCCCTTCCCGTAGTACGCGAGCACTGT
GTCACCGATATGTCCCGTCTTCTTCATTTCGCAGCGAAATTGTGCACGTAACTCCCGCATCTTTTCCTCGTACTCGTGATGTGACGAATCCAAATCATGC
CCAAAAAAGCGGTTGAGAAGCCGTTGAAAACTTCCTTCCAGATCATGTGGGAGATATTCCGTTGAGTATTCGATGCATTTTTGCTGGAGAACAATTGCAT
TGAGCTGCTTCATGACCACAAGTTGTCCAACTTGTAATTTCATCTTAACGCCAGCTCGAGGAAGCGCTTGAATCCAGCGTTGGACATCCGCACTCTTAAA
CTCCAGCACCATGCTCCCATCGGGCTTCAATTTCATCATCTTTGCCTTGCGTTCGTCATCGATTGGAAGATATTTCGCACTTTCACTATCACGAACAAAG
ACCGTTGCATTTGAAATCTCGAACCATCCTCCTTTGTCCTCGTGAATAGAGCTGTACGCGGCGTGGCACGAACCACTGTTCATGTCAATAATCGCAAAAG
GACACGAACACGTTTCAGCTTCGTACATGTAAATCGAGCGGTAGTCTGGGATGAACAAACAGTATTTCCAATCCCACAGCACGTCCTCGTCAAGTAATTG
CTTCGTTTTCTCGACTACAGGTTTCAGCAGGTCAGTCGCCTTAATCTCGGGTGAAAACAGGAGGGTTGATATCTTGGTGTGGGTTCCCAAAAAGTCCTCC
ACGTGATCGGTAAGCTTCTTTGAAAAAACACTCTTGTGCTCAGCTTCTAGGTTAAGATTCACATCTGCTGACGTCAGTCCAGACAATGGAGACTGGTAGC
AATCAATTTCTTGCACCAAATCTAATGGAAATAGGCTTTTCTCGCGACTTTGCTTCTTCAACCACAGATCCACTTCACGAAGACGATAGAAGCGATCAGT
CTTATCTTCCACCAGGTAGTAGTTTATATTTGCGTCGGTTGCCGCTCCACTGGAAGTCACATTTTCAATATATCCTGCGTCACTTAGCCCACTCAACCAC
ATTAATGCTGATTCTCGTGATCGTGGTGGCTGAATCGCGTCTGGATCTTGCTCAAGCTTGCCGTCTTTCCACCGCAAAAGACACGATGACTTGATTTTCG
GATCTTGGCAATACTTTTTCCACCCATCCTCCCACAGTATAGACGGGGATCGCAAAATCCAAGAAATCATTCCTTCACCAGTGAAAGAGTTTGGGTATGA
AAGAAAGAGAACATTCGTTCGGTCTTGAGTGAAGAATCCACCAATATCTTGCAAGGCTTTTTGTCGAACCGCACGAAGCTTGATCCACTCCTCACGTTCA
AGATCCGTCACAGGGATTTCAATCGAGGTCTTCGAGGCACCCAACTCCAACAATTCCATCTCGAGATGAAGTACAATGTCTTTTCTTGTTTCCACTTTGA
TTTCGTTGATCAGTCGACCAATCCACTCGCTATTCGAATCCGCACTCGTTGTATGCACATGCCGGAACTTCTGCATTTCTTCTTTCTCAAGTACTTCAAA
TTGCTCAAAGAGTTGAATCTCACGCAGTATACTCACAATTCGCTTCATAACGATCACAAGAACAACATGGAAGGCATCAATCTGCGCATTTTCTGTCGGC
GTCAGTGACGCACGCAGCATTTCACGACGCTCAATCCGACTAGGGGTACGAGTAGGCAACGTGAGAGAGGACGAGTAGGCTTGAGCTGCTTGGCGAGATC
GGAACCAGTCAGCCATCCCGCAAACAAATACCTGATCACTTAGCTTCGTGATGCGTTTTCCGTGTCCAGGCAAGTTAAACACAGCGCTATGTGCCTCATC
ATTCTGCTTGCACGTTATGTGAACGCATACCGATCCGACAAACCTGTAATACGGCGTGTTCTCACTCGGAATTAACTTGAGATTCAGTTCTTGCTCACCA
TCACGAAGACTTGCAAGGTCAAGCTTTGCAACTCCAATAGTTTGATGTGTTCGCGAAAGCTCCTTGTCGGTGCCTTGATCAACTATCTCGATCAAAATGC
TTGAAACAGCGGCAAGAATGTCCATGCTTTCCTCAATCAAATCTTGCTGTGTTTTGAAGCTTGAATCTTGATCATCATCAACTGTTTCTTCTTCCTTGGC
TTGGCCTAACCTTAGGGGTTTGATCTCAAACAAATGCCGATGATCCACGTCTGTTTTGACAGCGCTCTTACTCACCGGGAACTCGAATGACTCTCCAACT
TTCCAGCCAATGGAACGCATCGTTTTCTTAGCCACCATTTTACCGTTTGAGTGAACCGTAAACTTGTTCTCTGCCCCTGGTACCGCGGTTGGATTTCCAA
CAATCGTAATTAGGCATCCTGGGCAAGTTGTACCAGTAGGCAAGTTTGATACAGACAAAACTTCGACCTTCATGCCAGTCAAAGTATGCTTCAGTCGCTC
CCATTGCGAAGACGTGTCGTTTTTCTTGTTCACGCTCTTTGCCATCGTCTTCTCGATCAATGATGAGAACGAGCCGACTGGTGTAAGCAATGCCGGTGAG
ACGTTCTTGGCGTACACATTACTTGGATCCTGTTGCTCAAGTAGCACTACGTCTGCATTTCCATCACTTCGAAGGGCTTTAATTTTTCCTTTCACATCAA
TGGAAAAAATATTTCGAACATCATCCACTGTCTCGATGCTGCCTTCAAAAAGAACCTTGTACTCATCCTGAGGGAACGGATAATATCGTTGAACTCGAGC
GGGAAAAAATCGACCACTGCCGTGGCATTCTCGATACGCCAACACACGCTGGTCATATTGCAAGACTTCGCATCCATCATCACAGATCTCACCCGACGGT
GCCAATTTGTGCAGTTGGTGTCGCTTGAGATGGATCTCTTGCTGTCTTTCTCGCTCATTCAACAGCAACGATAGGTGCTTCTTCGTTTCTCCCGCTAAGT
TGCGAGTGTAGACGTGCAGAGATAGGTACGAAATAGCCGCTATATCTTTGACTTTGCCAAATACAAACTCTTGATCTGGCCAAGAAGGATTGCGCGTACC
ATAAACTGTTAGCCCCTGCTTTTTCTCGGAATGCTCCAGCTCACCTGTTGCCAATACCGGTATCACCGTGAAATATGCATTCGTTGACGACGAGTGGCCG
CGATGATAGTGAAGCTGATAGCCGTCTGACTGGTCTTGAGAATTTCCACCATTACTTGAAGCGACGCCTTGGGATCCTAGCAGGTGACGGCCGCTATGCA
CACGCAAATGAAGCTCATAGTGCTCAAACTTTTCAGTTTTCTTGTCGCTAAACATTCCCGGATAGGAAAGAGATAGCTGGAACTTCTCTTTCCTCCACTT
GGCAGCACTTCCAACGACCGCAGCCGTCCGAAATTCATTTTTGCAATCCAATACCTCCGTGACTTCATCTTCAAATTCCGGTAATGAGTCCATATTGAGC
GAAGAATTCATATCCAGCGAACTTTGGCTTTGGACGTACGGGTCTGTCGTGAAAGAAGAGAACGACAAGAAGCTCAGCAGCTTTTCAGGCGACTTCTTCG
GCATGCGCTGAAGCATTTCAGCAAGCACGGTCGCATCTCCCATAACTTCAGTCTTGATGCACAACTCGCCAAGATCTTGTGCATGCTTTTTCATCCATGG
CTCTGGAGCTAGTGGATAGCGTTTCTGTTGCGAGCTCGACGCGATAGACGTAGAGTTTGCTGACGCATGACAAAGTTCATGAATTGGAATTTGGATACGA
CCAAGTGGTGTACTTCGCCCAATGTTGTTGTGATCCTTCACGTGAATAAGAAGCATACCCGACTCCAATATTGGATGATTCTGATAAAAGAACGCATACA
AAGAATCAACGTTAGGACCAATGACGTTCGCAACTACGTTCACATGAGCGATAAAGAACACTTACATTGCCGAATATGAAAATTTCGTTCGTCCACACAG
GATTCAACGTTCTTGAAATGATTGCAGTTTTCTTCTTCTCAACTTCGACAGGCTTCCCTGTTTCACGATCAGTCACCGTGAGCGTGCAGTATGGATCACT
GTACCCTCCGATGTCAACTCCAGTTAAGCCGTGGCCGCTGATGATTTCAACTTTTAGCATCGGGTGGTCATGGTTGATCTCAATCGCTTTCTCCGAGCGA
GCTTCGTTTTTGGCAAGTCGAGATCGAGTTGTCGATACTTCAGCTGTGACTCGTTTCGAAAGCATTGCGTTTCGTGAATCGGCTGCTGCAGCATTTAGCG
CTTCGATACGCTTGCTCTTCTGTGGAGACAGCGGCGCGCTGGTTCTTTTGCATTCTTCGACACAAATAGACGGCTCCACTTCAATCACTGCATACGGGTT
CGAAGGTGAGAGCCCTTCCGGTTTCGGAAGATCCGATGCACCAACAACTGTCACCTCTAAAAGTGCTCGACCTTCCAATCCTGCTCGAGTCTGGAAGCTT
TCATCTGAAGACTGACTCTCACGATGAGCTCTTTCAATCTGAGTGTGTAGTTGATGAATGCACCCATTAATTCCATAGAACCTCGGGTGCCGGTCCTGGT
AATCGTCGACTGCACATGCGATTCGCGCGCCATCGAGTTTACAGGCTGCATCATGGAGTTCATACTGAGCTTTCTCTAGCTCCAACTGCTCGACAGATTG
CTCGTGAGTTTTGGCGGCAACTTCTTTGTCAATCTTCAAACGTCGTTTGCGTTCGCCTCGGCTTTCACCAAACAATAATATCTTGAGCTGAATCGATCCA
AGATTTTCCTGAATAGTCATCCCTGACTCAGGCTGTAATGTGTACCATTCCGCCGAATTGGAAGCCGATATCTCATCCAGGTCAATTAGAACAACACCCA
GGGGATCATTCTTCGAGGTCTTGTCCCAGTCAATCACTCGAATCCGCAGCTTCGCGGCTTGATCAATGCGGGAGACCATGCCAAACACGTGGTGCTCAGC
TTCCCACGTTGGATTACGCGTCTTGTACTTGATACTGGTGGTGTAGCTCTCCCCTCGAATTGGCTTGCCGTGATCGTCCAAAAGACTGCACTCGCAAAAA
GGATCGGACGAGTTGTTGAAATCGGCACTGATAAGATTCTTTGCCGCCAATATCGTCAATTCCAAGCGATTGTCCGTGTGCTCAGCACCAGCATTCACAA
TCCGACTGTGAGGCGCAAGAGCAAGATGCAAGCTCTGGAAGAAATCGACGAGGTTCGGTCCAGCAACGCTCATCACCAAGTGCAAGTCCCCGTGATTCTT
GAGCATGTCCTGTTTCGCTTGCACAACTTGGCGAGGTGAAGTAGACTGTTTGTGTGGCGGTTCAACGCGAAACCAATTGTCGATAACTTCGGAATGGCCG
GTGCTAGCTGGTGACATTCGGAAGATCGACAACGGGACGCGAACAAACCCTAAAGACGTGTTCCTCGTGATGTGATCGTGATCCCACAGCTCCAAATGCA
CAGCATCGACATTGTGCAGGTCAACTGCGTTCCCGATCGTGAATCTCGCATTCCAAACTGGGTTCAGCGTGCTGGTGATGTAGTTGGTTTTCATCTCTTC
ACTGCGAATCATCTCCCCGTTTTTACCGATAAGACT