Description :
From Genome Similarity Track
Location :
Scaffold_1331:3- 1204
Sequence
1201 bases(100 bases per row)
GCgtaccacaaagtgggtACCTTGGTCCTCCTGCCGATCCGGCTTTCTCAcaaacaagattctgctccaccacaacaCCCTCGGGCTTGTGCACAGTCTG
AGGTACACTTTCCGACCGTTTGGGTCCCTTTATATCCAGGCGGAGGTCTTATCCCACAAATCATTTTTTCCACATAACGTCCAATGTCGTACGGGTGCAG
CCGCGTCCCATCGCCCCTGTCTCCGATAGTAACCCATTAtttagccaatcacatcGTAGTGACGCGTCCAGAGAACCGGAAATAACAGCATGTCAGATTC
CAGAACTGTAGGACAGATTCTTTAGGAGTCATATCTTCGTTGCGCTCAACATCAATTGGATCATCCATCCATCGATCCAGCTCGTTTTCCGCACGACGAT
CGACATGGACAATTGTAGTTTGCCTAGCAACACGGGGAGCAAAACGCGCTTCCATCCTTGGCACAGGAAGAGATGTTGTTTGGTCTTGAGGAGCGTCGGT
CGGTCCAGCCACCGTTCTTAGTAATGCCAGCAAATTGTCACGAACTTTGTCATTGACATCCTTCAGTCTTTCTACAACTTCTCTTCCTGTTTTTCCATGT
TGCCGGCAACACTTCACAACAATTCTATTAAGAGATTCTGTTGTAGTTTTGTAGATCgggtgcagcttcagcaccatTTCAAGCACAAGGTGACTTTGCT
CAAACTGGGTGTCGTTGTAGTatcgaaaaaaaaacgctcGTCAAGCGCTTCACACAGCAATCTCCGGGTTTTAAAGGCCAATGGCGTTAAGGAACTCGCC
GATATCCATTGTGGATCTTCGTATGTAGACAGATAGTGTCGAACAGGTTGGTCTTCGCCAAGGTCATCCAAACGAGACATATACAAAGCCATTAGCACCT
CCACTTGTTCTGCTCGTTCCGCTTGGCACTTAAACTTCAATTCAGCTATTGGTTCCAAAATGGACAGCACTTGAATCAATTCTGTTTGCCGATTTTCAAG
CGGGAAACTGGGTGGAGAATTGCGATTACGAATGGCTTGCCGACCTCTCTCTTCGTACCAAGCTACAATTGCCGGCCACTTATCCAATACGGGCCTCATG
GCATTAGTCAATCCCAAGAAGCGTGAAGCGGAAAACCCCACCAGCTGCTCAGATGCCCCCTTGGTCTTTGACCTGCATAGTTCAGCAAACAAATCACCCG
T