Description :
From Genome Similarity Track
Location :
Scaffold_685:3- 1188
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_685-snap-gene-0.6Calcineurin-like phosphoesterase

Sequence
1185 bases(100 bases per row)
GTCATACTTGACTACTCAGCTCAGGATGTTTGGTTTGCTCGTCTTCGGTTGCAAGTAAAGATTGTGATCCTTGAGGCATCGTTGTCGCGAGCGTTCTCGT
CTTGCTGCTTCAATTTCCTTCGTTACTGAAGATGTTTTCCTTCGGCTGGCGTAATAAAAGATCATAATTGTGAAGTTTTAAATGTGATGCGTGCCATACA
CAATACGCAGGGTATGGATTTGGAGGTAATGCATGCCATTTCTACATGGTGTTCTTGCCTTTGGTCTTGTAAACTTTGTGCTAAAGTACTTCTTCGCACA
TACACTACGTGGTCCAGCAAAGTACTTGAATGAAGAAAGGAGCACGAATGCAAGCTTTACAAAGCAAGCATTAACACTCTTCTCCCTTGGAACCATCCTT
CGGGATGAGCCAGCAGTGGCCGACTTGGCCATCGCCTTTAACCGTATCCGCGGAACTTTTCTTGAACTGCCAAGCGTCGTCAAACGTGATGAACTGCAGC
TTCATCTGCTGTTTGCCAAAGTACAGCTCAAAGATGCCGTACGGGGTGTCGTGACCAATCCAGACCGTGCTGATGTTGGTCGCGTAGTCTGGAGGGCCGC
CGATACTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCCGTTCGTGACGAAATGGGTTTTGAAATCACCATATTCGTGGCTTTCAGCGTG
TGTGTGCCCATTCATGAAGAGATGCACGCCCGTAGCCGCGAGCACGTCGTTCCATTCTTGCATCATTGGCGGCGTCATGTGGAAATGCGGGGAGTAATGC
GAGTTCACGACCTTCCACGTCGCTGTCGATGCCTTGGCATCACGAGCGAGCTGGCGCAGCGAATCCGCCNNNNNNNNNNNNNCTCCAACTTTGTCAAGCA
GGCGTCAAACATGTCAGTGCTTCCCCCGGCGCACAACGGATGGCCTCGACCAACATTGTTACAGCTGGCATCGCCGCCGTATTTTGTCTTGTACCCGTAG
CACTGGCAGCAGATTTGCTCCCCACCATGGACCGTCGCCGCATTCGTGTCGACATTGAAAATGTCAACTGTGACCCCTGAGTCGGCGTCTTTGAGGGTTT
CGACATAGTACCGAGCGGGCATCTGCCAGCGATCGTTGTAGGGACTTTTGTATCCACTCTGACGAGTAAACTTCTCGTCCAGTTG