Description :
From Genome Similarity Track
Location :
Scaffold_752:3- 1180
Sequence
1177 bases(100 bases per row)
CACTCGTTTGGATATGTCCACAGCGGACCATCCGCAGACCGAAGGTCAAACCGAACGCGTGAGTCGCGTTGTGGAGGATACCCTCCGAAGCGTATGCGCT
GAGGCGCCAAAATGCTGGAGCCAGATGCTCCCATTCGTTGAGCTCGTATTAGTAATGCAGTGCACGCCTCAACAGGCTACACCTCGCTCTATGTGAGCGG
CTTGGTTAACCCTCGCGTCCCACTGACGCCGCCACGCAGTGCTTCAGGGCTTGATGGGAAAGGGATAGCCGAGCGGCTAGCTGATGTCAGCCCTGTTGCG
GTTCGCAAGCAAGTCGATGCCTTTGTCTCTTTGAGACTGAGCATAATGCGTCAAATACGCGACGCTATGCCTGAAAGCCAAGACACGCAGAGGGAACATG
CAGATGCCAAGGCAGAGCATTATTGAGAGGTTTGAGTCGGTGACCAGTTTTATTAAACGCTAAAACCTACCTACTCATGCAGTGTCTGCAGTCTTCAGAC
GAACTTAAGACCTCGGTTCATAGGACCGTTCAAGGTCGTGCCAGGAAGGGGCCTAGCGTATACGCTTCAACCTTCCGGAAGAAGATACGCACGCATCCGG
TCTTCTATGGTGGCTTGCTTAAGCCATACCAGGACCCTGCTCAGGTGAGTGCGGAGGCTGTTGGCACTAATGTGGCCTGGGCCCACGCACAGCTGCAGGG
CAGCAGGTGGTAGAGCCACGGGAGGCTGAACGACAGCAAGTGGTGGATCCACAGATGGCTGATCAACAGCATGTGGCAGAGCCACAGGTCGCGGAGCGAA
GTGCTCGAGATGCAGGAGCAAGGCAAGTTGAGCGTTCAGCCGAGCGACTGAACGCTCAAGGTCCTAGACCTGGTTGTGAGTCAACAGTGGTGGCTCTAAC
CTATCCACAAGGTGGATCATCTCTTCGAGATCGACCGATGGGCGGTGAACGTTCGCGTCGTGGACGCCGGCGTCGTATGGACGCAGACGCCGTTCCGGCA
AGTGCTGACTCTCCCCGCGAGAGCCCAGCTGAGGCAAGGCCTCCTCCTGCTCTGCTCGATGAGCATGGTGAGCTCCACTTTCACGTGGAACGCCTTGTGG
CGTGGCGTAGACGCCAGGGTCGTACCCAGTACTTAGTGAAGTGGAAGGGTTACCCTCACTCACAGAACTCATGGGAG