Description :
From Genome Similarity Track
Location :
Scaffold_951:3- 11609
Transcript NameFunction/comments
g17072.t1hypothetical protein
g17073.t1hypothetical protein

Sequence
11606 bases(100 bases per row)
CCATATCCACCGTTCTTTTCGGTCTTGGCCGAACCATCGAACGACATCACAAATCCGGTATAGGTCCTCGGTAGGCAGGCATAAAGCAAGTGGGGGTCCA
TACGAGCAGTAGGTGACCCTTTCGTCGGCGGTGTAACTGGGGCCAACGAGTCTTCCAACTCCACGAAGCTTGTGAGGCCAGCTTGGAGAAGCTGAGCAAA
CGTACAATCGCGTTCCTTGACTCGGTTGACCACCAGGTGCCACGGGGACAACATAACCGCAAAGTGGGTCGCTCGACCTAACAGTGTCTTGGATTTGTGC
ACCCATTCGAGCGTCGAAAAACGCGTATAAACGTGGATGGTCCGACCCACCAACTGGGAGTAGCACACTTTCAACACCAGCAGTAGCGCTAACACCTCCT
TCTCGGCCGGGTGGTAGTTCATCTCGGCGTCCTTGAGGACTCGGCCACAAAATCGAACCGGGTGCAACTTGTCATCATGGTATTGCATCAAAGTGGAGCT
CAATGCCCACTCATTCGCGAATAACGTGACATGCACCTCCTTGTCTCGGTCAAAGTGCCGGAGAATCGGTGCCTCTGCAACCTTCTGTTGGAGCGCGGCG
AAGCTTCGTTTGGCTGCCGAGAGGCTGCCACTAGGCGTGAAGTCTTCGTCCTTCAACTGGTACAAAGCTGCTCCATACACTGCGAAGTCCTGGATGAATC
GACTGTAATAATTCAGCGCACCGAGGAAAGACTGCATCCCTTTTTTTGAAGCAGGGAATGGCAGCTCGGTCACTGCTTTCATCTTCTTGGTGTCGGCTCG
AATACCTTCTGCAGAGACTCCGTGTGACAGGAAATCCACCTTTGGCTGGACGAAGATACTCTTCGTAAAGCTCACACTAATGCGACATTCGGTGAACCGT
TGGAGCAGACGGTCTAACGTGTCCAGGCACGCGTCGAAAGTCTCGGACCCAAAACAGATATCATCAACAAACGACCGTCGGTCGAACACTGGCACCAACG
AGGATTCATCCGGTTCTCCGGTGGAGAACATGTCGGCAACAGGGCTGTTCACTAACTCATTCACTGCGTCAAGCGTGACCGAGGATTCGCGGTCGGCCTC
GAATTTGGTCACCCGAGTTGTTGACTCCTCGAGTTGTCGCGATGAAGGGTCGGTCACCCCTGTCCGCGCAACCTCGGCGTGGGCTTCGGCCGTTCGCATA
AGCTCCGAAAAGTGGAGCCAGCCGCCTTTGGGTTGAACGAAACCCCACAGAGCATTGTCAATCATTCGTTGGTAAATCATCGGTGCATTCTTCAATCCAA
ACGGCATACGAAGCCATTCGAAATGTCCGAGTGCACAGACGAATGCCGAGACTTTGCGGGCCCGCATCGTCATCATAATAGCCCAGAATCCACTGGCCGC
ATCAAGTGAGCAGAACCATAGGTAGGCTTTCAGGTCGGTCAACAAGTCGTCGACTAACGGCATGGCGTACTCCATAATCGCCGTAACTGCATTCACCAGC
TTGTAGTCGATGCACAACCGAATATCAACTCCATTTTTCTTGAGCACGATCACGATGGGCGACGCCCATGGGCTGTCCGAAAATGCCACTAGACGAGCTT
TCAGCAAGCCTTTCAGAAGCTCGTACAGCTTCCGGAGGTGTCGGAGCGGTGTTCTCCGAGCTCTCTGTTTGATGAGTGGATGCCCCTGTACGTCAATATC
GCACACCACGCCGTAGGCCGGTGGTGGCAGAGCATTCCCACTCGCAATCATGATCTTCTCGTGTCATTTCAGCACCGCAACGAGACGTTCTTGTTGACGG
GCTGTCGCGCTCGGGTTCAGAACATTCGGTCCTGAATAATCCAGTACCGTTTCCGAGGCTTCGGTCAGGTCCGGTAAGAACGCCAACTCGTGTGCATAGT
CCGTCAACTCGATCTCATTCGCTAAATGTTCGGACGTATTGGTCTCGGTGTTCCCACCCACTACCTGAACCGTCCCCCGCGGCAATCTCATGCATCATTG
CTACGAAGGCAGAGTCCAATCGGGTCTCCGGGTCATCACCGAGGACTGGGATGGAGTTCTCTTCACTCGTATACGTGGTATCCGCGCCATCAGAGGTGTC
GGTCGCCACCGAGTCGTCATCTTCGTCGACCCATCTATCTCCAACGGGTTCGTCAGAGGGTTGCACCGAAGTCGTCAACGGCGTTCGGTCTCGTTCTGTC
GGTTCCTCAGTGCCCCTATTCGCGAACGTTATCTGGCCCTCGTCTAGGCCTTCCAAGTCGTCGGATGGTCGAGGTAGGATGCCGCTAGGTGTCGGATAGT
CTCGTCGTTCTACAGCTGGTGGCTGATCTGCCAACCATCGTTCGTAGAGTTTGCGTTCCCGCGCGAACAAAGTCTCGTCTCGACACTCCGCGTACGCCAG
GACTTGCCACTCCTCATACTTGGCGGAGTTCAAACGAGTGTATCCATCCCCTTGCGGCAGGTCACCCTTTTTCACCCACAGCAGTACCGATTCGTGTCTC
GCGCAGTGAGCAATCTTCGGTGACACGTTCGTTAGTCGCACCATCGTCGGCTGCCCTCGTCGAGACCTCGTTACAGTGGGCACCAGGTTTCCAATCCGGC
GTGCCCACACGTCGTGAGTAGTCAGAGGCGGCCGTCGTCGTGGTAACCTAAATTCTCGCCACTCACGCCCTGGGACCGACAAATCTTCGGTCGGGCGTCC
AGTCACTTGCATGCTGTACGGCTCGGCCTCTGCTGGGTTCTGCGACTTCACCAGGGGCACCATTACCTCGTCCGGTAGTCTCGCAGTGCCGTGGAACAGA
TCCAACCGGACTCCGGCTGGAATCATGAAGTCTGTTCCCAGGACCACGTCCACTCCTGCACTGTGATCCATAACCCATACTTCAAATTCGTACACGCGCT
CCCAGCCTAGCGTGACTTTAACGAGTGCTCGTCTGCGGGTCTCCATCACCCCTGGGTTAATTCCTCGCACTTCCAGACTCCTACCGTGATCTGGAACTTC
GCGCAAGCGCAACCGTTTCGCGTATGACGCGGAAATCACACTGACATTCGCTCCAGTGTCTAGCAGAATCCTCGTTCGCGAGTCGTTTACAGCCCCATTG
ACGAGGGCTCGCAATCGCTTCCTCTTGTCATAGCGCTGGGATGACCACCACCCCATTCTCTCGCCAGATAACAGTTTAATCGTCTGGCCGAGGTCTCGGG
ATGGATGGTCGATTTTGGCCATGCTGAGGATCGAAGCATCGGTTAGCTCCACTCCGTCTCCGTCCACACGTCGTCCATTCACTTCACTCTCACCGAGGCT
TACGCCTCTCTCCTTTACATTTTCCGTCGTTTTCACATATTCCATATTCAAGTCATCAGGCCGTTTGCTCACACCTGCGAATGCGAACATATAGTCCGCA
TCCAGCGCAGGTTTGGCTAACTGTGGCAGCCCGATTGGGACCAACCCAGTTTCAGTTGGCGGGCTGCCTAGTTTAAATGACTCCCATAGACGAGTTCTTG
CAACTCCGGCGAGAGGTCCTTCTTCTCGACCTTAGCTCGGAGGAGATTCGTGAGTTCTTGGAAGGCTTCACACTTCCCGGCATCATGAACCTGTTTGCAC
ATCTTGCATCGCTTAAAACAGTAGTGACCCGAATGGGTGAGCCCTCCGCAGGCGGCGCATGGACCATATTGGCGTCGACCATCGCGTCCGGTGGAGTTTC
GGCGCTGGTCGTCTCGGTCATACGGGCGTTGGCCGTTACTTGCCCTCGGCCGACGGTTGTCGGCGCGAGCGAACGTTCCTTCAGCCGCATTGCGACGTTC
AGAGTCGTTTGCGGCAGCCACGTGGCCTCGGTCCTCGGTCGACGCGTATCCGTCGTCCGAGTACCCTTCGGAGTATCGGTCGTCATCGCCAGAGTGAGAC
TCCGGCCCATACTCCTCGGTGTCATCATATCCGTCGTTGTACGCTTCCGGGTATCCTCCACGCGCGTCCACCGAACGTCCCGCATTCAGTGCTGTCACTA
TGTTGGTCAGTGCGTCAGTGAGAGTGACCCTCGGTCGATATTGTTGGTCATCCCGGCGACGGTTATCGTCTCGGTAACGGTCTTCTCGACGACGGTCGTC
CTCTCGGTGACGTCGGTCTCGGCGATAGCCGTCCCGCGGATCCTCGGAGCGCCCACCATCGCGTCGGCGTGCTACCTCTTGCCCTCGAAGGCGGCGGACC
GAGGACTCGCGTCCAGATTTTCGCTCCCTGCGACGAAGGATATCATTGATCATATCCTCGAGGTCGTGAATGTTCTTAACTCGGACATGGCACAGACGCT
CTTCTAGACCTCGGTCTTCACACGAATCCAAGAAGTGCTCGACGTGGTCCTTTGCATCACGACCGCCATGCTCGAACTGCACTCCGGCGTTGCGAGCATA
GCCGTTAAGTCGGTTGAGGTAGTCGCAGACATGCTCCTTCTCCTCTCGCTTGGCCGAGTAGTACCGAGCCTTCGCAGACTGGTTGAACCTCGAACAGTAG
TACTTAATGAACGCATCGCTCAACAATTTCCACGTGCGTCTCGTTTTGCGGGGCAGCTGTCGGTACCAATGCAGAGCACCATCTTGGAGGCTCAATTCAA
ACGCCATGCACCATTCGTTGGGCGGCGTGTGCGTCCCTTTCATCTCGTATATGAACGCTCGGAGCCACTGCATGGACTTCTCGCTCTTATCGCGGAGTCC
CAAGTACGGCTTGATGTTTCCGAGTGGGAGGTGCGTGGCGATCTCTAGCCTCGGTGTCGCACTGTCATTCTCCACCGCGCTCAACTCACGAATTTGGCGT
GCCCATTCTCCCGTCAAGTCACCCCCGGTGTCTCCGACGTCGAACGAATCTTCGTCAGATGAGTCGTCGCGGAGGTCGTAACGTCGGCTGGGCGTCCGAC
TTGCGCTTCGTCCAGCAGTCGGAGCGGTTCGATATCCCTCGGCCTCTCTCGCCAGCCGTTCTGTACGACTGACCGACCTTGGCGTCACCATGTGAGAGTC
TTGGAAGTACGTCGACGTCGCCCCTTGGGCCGAAAATATTCCGGCCTCGGTCGACTCTCTGGGGCGTCTCCCAGGGGTCACTGGCAACGGAATCATGGAC
GGGTCGACCGGATCCGATGCGTGGCGGACGTTCGGTGGACGGCTAACTCCCGCCTCGGCCACCCCGAAGGCCGACCGAAGCTTCTGCTTCCACTTGCGAA
GCGCCGTAGCGGCGTCCTCGGGTGCCCATGCTCGGAGGTCTGCTTCCGACGGGAACACTTGGGGTTCACATCCCATAGCGCGTAGGAGTTGCACCGTGTC
CTCGGCCACCTGCCGAGTGTTCCACGCCTCCACGGGCACAGTTAACTCGCCACCGAGCTCCATCCAGATGGCTTGGCGAACAACCTCTGGAGCGAAGGAT
CGCATCCAATTGCTCTTCACCTTCATGAGTTCTAGGTATCGACCCAGAACTCGGTTGGCGGCCGGGGTGTCTCCGTTAAGAGGAGGCCGGCCGCCATTCG
GTCGAGAATTCGCATCCTCGGCCATCGCCGACGATCGGTGATCGTCGGACTCATCTTCGTCGTAACCGTTGGCTGGTTCGGGACCAGCCACTTCGTTCAA
CTCTTCGGTGAGGTTTCGCGCAAGCGACCTCACCCCTCCGCTGCGTCCTGCAGATACTGCAGCGGCTTCCGAAAGCTCGGGCATAGCTGCCTTCTCTTCC
AGGTCATCTTCTTCGTCATCTTCCTTGGCGTCAGAATAGTCCATCGGCTCATCAAAACTGTCCGAACGCTCGTTGATCGACGCCAACGTACTCGGCGTCG
CGAACGACGAACCGGAACGCCCCGAACCCTCGGTAAGCGTTCCACTTGACCTCGCCGGCGTTGCTGGTACCGCTGACTTCGCTTCTTTCGCCATCTTCTT
TCTTCTTCTCTTCTTTCTTCTCTCGAATGCTCGTTAAGGTAAGAACCTATATGCAACCAAGACACACAGAAGGTTACACCAATCCCGGGTCGCGGCACCA
GTTGTCGTGTAGGAACACGCAGAAAATCTCACTACCGAACGGTATGAGTCCCACCAACAACACACGCTTCCCTCGCGAAAGATCAGCGAACGTTGGATCA
ACACCTGAAGACCAGGAACGATCCCTTACACCGGGTTGGTTGTAAGCACCTCTGTATACCAAGGTTGAGTTCGGTCAACCTTAAAACCTGCACTACTAGC
CACGAGCGAGGGTTAGAATGCAATATTGCGCTTTCGCGCGAACCCCCGCAGTCCCTCAGAAGTAAGGGTACCGGCAGTCACGCCTAATACGGGTTTGCCG
AGGGTAACCTCGGCGGGTAGTGAAATACACTTGGGAACACTCGGGTTCCACCAATATATAGGGACCGACACTCCTTGTCGCCCCTAACTCTCGGCCACTC
CTATCTCTTGGACTGACCAGCAACAAACTCTCGGTTCAATGTACCTCAAGCTCGCTGACAGGCATCCCACACAACCGAGCGTATCCAGACCCTAAGACAA
GCTAGCTAGACTTACCGAAGACGGACTTGACCCTTGGTGGCTTGTGGGGAAGACTGCTGATTTATTTCTTTTATCCTACAGCTCTGGGAGCCTCTGTAGG
TCATCATTTGGCTAGTCCTATATCTATACAAATATCAAGTGTAAACAGATCTCTGTGGGAAATCGTATAGCCGGCTCTACACAGCCGAGGGTACGACACG
AAATGGGTACAAACGAGGCTTTTAACCTCGGCCGGGGTTTTATTAGACCCAGCCGAGACCTCGGTCACTATTGTTCCTAGGTCACTACAGCGCGGGAAAT
GAGACCCGCCAATCAAGACGCTCTGTCGCCGTTCACTGAAAGGTGCAACGTCAGCCGAACCGTGACAGTTCGGCATCAAAACCCAACGCCACATCACCAT
CCAATCCGGATATTGCTTACGCGCTCAACGCTTTAAACGCGTCATCACCGAGGTATATCACACGAACGACTGATCTCTCTTTCGTGGAGAAAACGGCTAT
CCTATTCGTTGTGACGAGAGCCCGTGCTAGTCGTTTTCTTCTTGTGGAGGTGGAATTGACGCGGAAGACGTTGATAATGGTTCACAAATCGAGTAGTCCT
CAGCTATCGTTTCAAAAATTGGCTTTGTATCCACTATGAGTACAAGTATGTAGTAAAGCCATTCAATGTTCCGTCTCGCTGCCACTCGTGGCACACTCGA
TACTACTCCGACAGAAAGTGCTCATGGTTGAGCGTGAAATGCATATCTAGAATGCCTCAATATAAGTATGTCTTCATCATTCCCCACAAAAGGGAAACCG
TCGTCATCCTTTCGATTTCCAATGATGAAAGCTGTAATGGGTCTGCTTAGACCCATTACTTAAGCTTACACGTGTGCGCACGCGTATGAGGAAGCGTAGG
AGTATTTAACTTAAGTTCAGTATACTTGTATCCGCAAGTATACTTAAACTAAGACAAAGGGACCGAACGATAGCTTTGGTGCTAAATGAGGACTGTATTG
CTTGTAAATGGGGTTTCCTCCTAAAATTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTTATTGGT
AGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCTTGTGGAGTGGTCAACCTGAATGTATCCCTTAGTGCATGTTGCAC
TAAGGTAGGAGGTGAACCGAATGTGTAGCCCCGCTACATGGGGGGGGGAAGACGCCCCGGGTTTGGTCAACCAAACCTTGAGTCTCGCTTGGAGGCTGTT
GAGCGTCTCCAAGCGTCGCAGTTCGCTGCTCTGCGTCAGGAGCTAAGCTTGTTGAAGGCTCAGCTCGCGGAGGTTGCGCAGACGACCTCGAACGTAAAGG
TCGAGGTCGGGACGAGGCTCTCTGGCGTCTCGAAGCGCGTCGCCGCGCTCGAGAGCGCTTTGGCGAGTCACCAGACGTAGGTGACTCGTGCTGCACGTAC
GGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGAATGGCC
CAATGAAGCGCGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGAGTAGCTAACAGAACTAATGAACCCACTTTGAATTC
ATTTGTGTTTCCCCTGCCGGTGTTATCGGCGTTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCGTCCTGGACAAACCGAATTACGGCTTGTCGGCGC
TGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGATGTCCGTTGTGGTTTAAAG
TGTCTACGCCCGTCGTAGACACTGCGTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATTGCTTGTATCAGCGTGCTT
ATCCGGTTGTTTTGAATTAACCGGATATCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCACG
TAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGCAGC
TCTTCATAGTGTCAACCAACACGCGGTTGACACGCTCTGTTTGTCCGTTGGTCTGCGGGTGATCCGCAGTCGACATGGACAACTGCGTCCCAAGACGTGT
AAACACTTCTTGCCAGAATCGCGCTGTAAAGCACGGATCCCGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTAAACACCAGGTCAACAAACAGA
CATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCTTGT
TGTCTTGCGGAAGACCCAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGG
CTTCACGCGCTGGCATACCTCGCAAGCACGAACGTACTTGCGTACCCATTTGCACTGGTGACTCCAGTAGAAGTCACGCGTGAGAAGCAAGTATGTCTTT
CTCACGGCCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCGTACGTGATCTTGAGCTTCAGCTCATGATCATCCGGCACGACAATGCGATCTGCGTTG
TCGTCGACTGCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGAGCACGAAGGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAAG
GTGTGGAGAAGTACTCCAACAACTGCTTCGCATCCGCATCATATGCGTATGCGGCCTTCACGTCATCCAACAAGGACGACGAGGGTGTAGTCGTCGGACT
CTTGCACCGCATAATCTGGTCGACGCGAAAGCGCGTCGGCCACGACATTCAACCTTCCAGGTTTGTACTCAACCTGGAAGTTGTATTCAGCAAAGAATGA
CAGCCACCGTGCCATTCTTTGGGATATGTGCGGCGACTTAGTCGCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAAGTAGA
TACACTCGAAACTTTGCGAGTGCATATTTCATGGCAAGGAGTTCCTTGTCATGTACCGGGTAATTGCGCTCCGCTGGCTTCAGCTGACGCGATTGGTAGT
AAACCACACGATCGACCTTCGTGATCGAGTTGCATCAGTGCGCATCCGATCGCGAAATCGGATGCATCGCACACAACGTGGAATGGGCGATCTTGGTCGG
CCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACTGCTTCAAAGACCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAG
CTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACGTTTGAAGGC
GTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCTACGAGACACCCAAGTACGGGTATCTCGGTCGGCCCCGAAG
ATACACTTCTTCAGGTTTGCATAGAGCTTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCACATCCGATCTTCCATTCA
CAGCCCGGCTATGAATGAACACGTCATCGAAATAGCTCGGTGCGTTCTTCAGCCCCTGCGGCATCACGAGCCACTCCCAGAGCATGCCGCCGGGAGTGCT
TACCGCTGTGAGAGAGATATCACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTCGAGGTCATCGAATCG
ATGATCACATCTTTTCGAGGTATCGGCGTCTGCGCCGGTACCGTCGCATCGTTCAGCTTATTGTACGCATGAACGATGCGCCACCCGCCCTGTGGCTTCT
TGACACAGAACGTAGGCGCGCTGTGCGGGGACTTTGATTCCCGCACTTGTCCTGCCTTGCGACGACTTTCAAAGAAGTCGTCGATTGCCTTGACTTGCTC
ACGCGGCAGTGGCCACTGTTGCGTGACGCAATACTTCGTCCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTGTCCTGCGGTAATTCCGCAGGAATG
TCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAAGGGGTTGGCTTGAGCGAGTCCCAGCCTTGCTCGTCGAAGCGTTCCTTCTTCGACTT
CGCGCTGAGGGCGTCCGCGCCCTCAGAGATGAGCTGACTCAGCTCTTCTGCTTCACGCGTCATCCTCTCGACGTCCGAGAGGATGCAGATCTGCTCGATG
CGTCCATCGTGCAGGTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAATGTCGGAGGATTATCCAGCGTCATCTTCT
TGTATTGGAGACCAATACTTGTACGCGTCAAGACACTCAATGTCTCGACGGTCGTCTCCAACTCCTGTGTCTGCCAGGCAGACACTGCTTTGAGCGTCTC
GGTCCCTGACCGAGACTTGCGCAGCTTTTCTCGCTTGCGCCGTTCACTTCTCGTGTGGAGCCCGGCTCCGCGAGTTTCTTCTTGTCCAGGCCCGGCCGTG
GACAGTTGTTCCTTGTATTCGCCGGCGGGTTTTACCCGCGGGCGCACCGCTTCGTCGTGCAGCCCGGCTGCACGCGAGCTCGCAAGCATTTCCGGTGCGG
GACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGACGCGCCTTCTTTACCTGAACGCCTAACGGCGGAGTGTCTTTCGACAAATTG
TGTGTCGACATTACCTGTCGACACGACCGCGTCGCCCCGGACGCTTCGAGACCCTCTCGAATCTGATTGAATCAGGCCCTGCTGATTCGTTTCACATCTC
CTTCCA