Description :
From Genome Similarity Track
Location :
Scaffold_4079:3- 1151
Transcript NameFunction/comments
Phyta_totarag15628pol protein

Sequence
1148 bases(100 bases per row)
TCGCCACATCTCTCCCAGCGCATGGCGCGATGGTTTTCCTTCTTCGCTGAATACAACTTCACCGTGGCATACAAGCCTGGCAAGCAGAATGTCCTCGCGG
ATGCACTCTCCAGGAGACCGGACTACGAGCTGGCTCACATAGCCTTCCTCGAGTCGCCGCTCCATGAGCTAATTCGCGAAGCCTATGCGGACGACGGCGA
ATTGCGCGACCTAGTCGCGGCGCTGGGCTGACGGGAAGTCCATGAAGCTTACAGCACGACAGCGAGCGCGATTACATCGCTACGAGCTAGTAGACGGTCT
ACTCTATTACGAAGTCGACGCGGGCGACGAGCTCCGCATTGTTGTGCCGCACAACGAGGATCTGAAGCACCGAATCCTCTATGAGGCTCACGATACCCCG
CTGAGCGGACATCTCGGTCGAGAGAAGACGTACGCGTCTGTGGCACGTGGTTTCTGGTGGCCCCACATGTACAAATGGGTCCGGAACTACGTACAGACGT
GCGAGACGTGCCAACGTGTGAAGCCGGCTCCCTCGATGTCAGCCCCGCTGATAAGCCTACCGGTACCGGCCGACTGCTGGCGCTCTGTGAGCATGGATTT
CATCTTCGAGCTACCGCCCGNCACCATGGCCTCCCCGAGGCATTTGTAAGCGACCGAGACCCTCGGTTCGTGTCTTACTTCTGGCAACACCTCTTCCGCC
TGCTAGGCACGCGGCTGGACATGTCCACGGCGGACCACCCACAGACCGATGGTCAAACGGAGCGGGTGAACCGCGTGTTGGAAGACGTGCTGCGGAGCGT
CTGCGCGGCAGAACCCACGAAGTGGAGTGCACTTCTCCCCCAAGTGGAGTTTGCACGGAACAATGCCGTGCATTCTTCAACGGGTTTCACCCTATTCTAC
GTGAATGGGCTGTACGTACGCCTCTGGCGTTGCCACCGGCTTCTGGTTTGGGTGAGGGAGAGGCTGTCGTCGAGGACCCACGGGGTCTCAACGGAGTGCG
GGCATCCGTCAAACGGAACCTTCTCTCGTTTATCGAGGAGGGCGAGGCGGTCCGCCTGCGCGTCCGAGACGCcatggcagcagctcaagacacACAAAAG
AGAATAGTGATCGCCATGGGCGGAAGAACACGCAAGTGTTTAGTCTGG