Description :
From Genome Similarity Track
Location :
Scaffold_4445:3- 1147
Sequence
1144 bases(100 bases per row)
GAGCGGAACTACCCTGTCCATGAACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTCGCCTTCTGGGCTCTAGGCCCTTTGTGAAC
TACACAGAACACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCGAAGGATGGTGAGGTGGCTGTCCCTTCTTCGCGGAATACAACTTCCGC
GTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGTGCCCCGACTATGCGTTGGCCCACATCACGCGGGTGACAACGGATCTAT
ATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTCTCGTCAAGCTCCTTAAGGCGGAACGAGCGCGAAGTCCGACTGGCTCTCGCCG
CGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTGGAGCCCACTGATCCTCCACGGGTGGTCGTACCCAACGACG
AGGATCTGAAGTTCGACATCCTGGCGAAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTG
GTGGACCCACATGTACAAGTGGGTCGCCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGC
CTGCCCGTACCGGCTGATTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTTGGTGTTCGTG
TGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTGACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACG
GTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACTGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCAGATGTCCAC
TGCGGATCATCCGCAGACAGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCGCCACGTACGTGGTCG
ACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGGT