Description :
From Genome Similarity Track
Location :
Scaffold_176:3- 1139
Sequence
1136 bases(100 bases per row)
CCCATTCGTGCAGCGCAGCTATCGCGGCCTTCTCTTTGGGTATGTTTGCTCTGGAGGCGGTTCAATCACCACAGTCGTCCTCTCGACTAATGGTACAGGA
TCTGTAACAGTGTTTTGCTCTGGTAACAAATGAGCGATGTTTTGAAAACTCCGGTGAGCCGCTAGCCTCTCCTCGTTCTGAACCTACTTCACTCGGATTT
GACCTGCTCTCCCGCGAGACCGCAATCGATTCGAAAGCTGTAAACTCCATGCTAGAGGAAAACGCCGTTTGTGCTGGGAAGTGTGTGCGAGGGAGCTGTT
TTGAATATGAGCGGGAGGTGTAGCGAGATAGATATCATTTTTTTTTTCTCAAACTTATCTAAACTATTTTAAACATCGCTATAAATAACTTTGAAAATAT
GACGGTAGAAAATGAAAAAAACTTCGGTATTGTCCTGTACAAAAAAGCTAACTTAAGTTCGGCCGGTACGGACATGCTCCGGGGGAACGGACACGTTTTA
GTAGAGCTCAGTATGATACGAACCTGCTGGTGCGAGAGAAAATTACAGTCAAGTCTCCTTGAGCTTGAAGAGCCCCCTTTTTTTGAAATATTTTTCTAGA
ATGGCCCCTCCTTAGGATCACCCAAGCGTGAGTGGTGATGTCGACAGCGACGATACGGTATGCAAGCCGACAAGCTGGTTGACCAAATCCGTATGAACTG
ACTTTTTCCGAGCTGCTGACCAAATTCGTATGAAACCATTCATTTTCATTCATATTCGGTTAAGTACGATTATGTTGTCATTCCAGGTATTCGATTGCGC
GGGGGGGGGATAATTTCTCACAGCTTCACTGTATTGCTCTACTACATCTCACAGTTTCACGGTACGTAAATTGCTCTATCCACCCCTCATCAAGAGTATC
ATGCGAGCAGCTAATCGAGGTAAAGTGGCCATTTCTCGGGCCTTGCGGACCCAGCAGCGCGTGTTGCAGAGCCTTTCCGTCACGTCCTCCGTGTCTCCAT
GCGTCTCCGCTTCCTCCGCTCGCAATTTCCACGCGTCTAGCTCAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN