Description :
From Genome Similarity Track
Location :
Scaffold_573:3- 1129
Transcript NameFunction/comments
Phyta_totarag9360crinkler (CRN) family protein, putative
Phyta_totarag9361hypothetical protein

Sequence
1126 bases(100 bases per row)
CGTAGCTAACTCCTGTGCAGTCCAAATCTTGTCTTTCTTATTTGTTGGGGCTGTGTTGTCCGGAATTTTGACAAGAACGTGAAGTTCGTCTGTACTggct
tctccagcgtctgggAAGGCGAACACAGCGTTGCCGATCTCCAGTTGCGGGTTcatttcctcctcgtctttcGTCATGTTTCTGATACTGTCGGAAATCT
CGCCAGCCTTCAGTTGTTTCACGTCGGGGTCGGTGTACTTGAGCCAATTGccgtcgtccttcttggccaggtAGAGTGTCAGTCGGTCAGCGGAGAATCG
GTAGTTCATCTTCTCTTTGATCATCTGCTTCGCGAAGGCAACTGTCTCGTGTTCCTCGATCTCCAAGCGGAACGGGTGTCCTTCCGCCACACCATTCACC
GACTTCATTGTGCCTCGTTGATAGCTTGGCTAGGAGACAACGGTGGGCTTTAGCTAGAAAAGAAAGGCTGGTGGAACTCGACTTGCGCTGGGAAGGAGAA
ATCCAAAAGTGAGAGGAAGTTTGAGTTAAAGCAACGTATGTTCAGTTGCTTCAACTTACATGTGttcactttccaatttgTGTGTTCCACATATGCTTGG
TACACGGACTTTTGTGGACCACTTGCTGGATCTTGAAAAgtcacagcagcttcaacatctttTGGTGCAGTCGCCAATaatggaggaagagcacgagcac
CACACGGAGGATGCTACGTGGGACGATTACAACACACATGTGCAACCTGACAGGGAAGACGACGAGTCGCACTGGGTCGAGTGCATCAGCGACACTGGCG
AGACGTATTTCAGCAACGTGGTCACAGGCGAaacttcgtggacgaaccCAGGATCGGAACTagagcaccacgaccagTCTGCTATCTCAACAGGTGACGG
CACTGAAGAGTTTTCAATCCAaaaaaatgctgctgctcactggGGAGTTGCTGAGACGCCAGTAGACgctgcagcgagcgaagcTGATGAGGTCACTCAG
TGGCTGGAATTGTACGATCCGGTCCAACACGTGGCGTACTACTTTGCGCCGCAGTCTGGTGAAGTTCGTTGGGAGCCGCCTCTGGAAGCTACAGCTCTTA
TTCAACACTGCAATAGCGACGCAGTG