Description :
From Genome Similarity Track
Location :
Scaffold_3904:3- 1099
Transcript NameFunction/comments
Phyta_totarag15541reverse transcriptase

Sequence
1096 bases(100 bases per row)
TTCACGAAGAATGGAGTCAAGCCCGTCGACGCGTGCACTGAGTTATTCAGTGCGGACTCAGCCATGAGCAGGAACTCGCTCCTGGACGTGTACGACGTGG
CGTAGCTGCAAAGCACATCTTTGAGCACGCGATTCGCGCGATCCGTTTGCCCGTCGGTCTCCGGATGAGCGACCGTGTACATGAGCAGTCTCGTGCCGAG
CAGTTGGAAGAGGCGCGTCCAGAAGGCNacacgacgtcgacgaagacagcCGCAGTCTCCTCGGCTGTGACCAGAggcaggaactggagcgagatgcacc
atcttgctgaatctgtcgacgaggacgaggatgcCCAAGCGCTCCTTGGCATCGGTGGGCAGTCCGAACACGAAGTCCATGCTGACGGAACTCCGcacgt
cagcagcaacaggaagagGTCGCAGCGGGGCCTGTGACGACGGTGCCGGCTTGACTCACTGGCACGCCTTGCACAGGAACGGACCCATTTGCGCACCCAT
TTGTTCATGTGGGGCCAGTAGAAGTCGCGCGAGAGCGAGATGTAGGTCTTCTCGCACCCGAAGTGTCCGCCGCTGGGACTGTAATGGTactcgtggagaa
gctgcgcacgGACATCATCGTCGCACGGCACGACGACCCGGGGAGTGGCGTGACGGTCGACGCTGTACATCAGCAAGTCTTCGTCGATGCTGTAGCGCGC
GATTGACGCGCGCATAGGCGCTGTCAGTGGACGCAGTGCTGACGCCGATGGGTCACAAAGATACGCAATGACGCCGGAATAGAACACGTCCGCCTACGCA
GTGGATGCGATCTGTTCGCGCAGGGTCCCGACGGCGCGACCGGGGACTGCGTTGACGCCCGAGGCTACGCAGACTGCGCaatcttcgtcatcgtcgaagt
CATCTGCAGGCAACGACCCCGATCGCGGGTCGTACTCAGGCCGGCGTAAGAGCGCGTCAGCGAGGATGTTCGACTTACCAGGCTTGTAGTGGACGATGAA
GTTGTACTCGGCGAAGAATGACAGCCACCGCGCCATGCGCTGTGACAGATGCGGGCTCTTCGTTGCCGTCTGCANGGAAGGCCTTGTCGTGGTTGG