Description :
From Genome Similarity Track
Location :
Scaffold_6410:3- 1085
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_6410-snap-gene-0.1Glutathione S-transferase

Sequence
1082 bases(100 bases per row)
CTGGCCGTGCCGAAGCCATCCGCATCGCTTTCTTCGTTGGGGGTATTCCGTTTGAAGATGTTCGCATTCCACGTGGTGACATGGCCCAGCGCAAACACGA
GTTTCCGTACGGTGTCGTGCCTGTGCTGCAAGTCGACGACGAATTGTTGGCCGAGTCGAGTGCTATCGCCAGGTACGCTGGGCGACTCGCGGGTTTGTAC
CCGACCAACAACCCGCTCGCGGCGCTCATGGTGGACGAGATCATGCTGGCGGTAGACGAGTTTGGCGAGTCCTTCCGTCCGTGGTTCACAGCTCAAGATC
CGGTTGAGAAGCAGGCAGAAGAAGCCCAGCTGCTGGCCGAGACCATCCCCAAGTACCTGACCCTGATCGACGCTCGTCTCGCTAAGATGAAGGAACACGT
GACGTTTCGAGACCCGTCGCGCTTGTTCATCCACGAGCTCTGGGTGTACCAGTACCTCCACACCATGCTCCAGGCTAGTTGGTTGGCGTTTGTGCCTAAC
GATGTCCACAAGAACCACAAGCACTGGGTCGAGTTGGAGGCCAAGGTCGAGAACCACCCGCGTGTACACGAGTGGAACACGCTGCAGCCTATGCGTCCGC
AGAAACTCAAGCTGACGTACTTTGACTTTGGCGGTCGCGCTGAACCGATCCGTCTCGCGTTCCACGTCGGAGGCATCGCGTTCGAGGACAATCGCATCCA
AAGCCGCGAGGCATTTCTTAAGCTGCAGCCTGAGATGCCGTTCGGTCGCGTGCCCACGCTCGAGATTGATGGTAAGGTCACCATGTCGCAGTCGTTTGCG
ATCCTGCGTTACGCCGGGGGACTCGCTGGGTTGTACCCTACGGACGCCGACGACCTCGCAGCGCTTCGCATCGACGAGCTGCTGGCTGTGTTGGACCAGC
TTCAAAATGTTTGGTACCCTGCGTTTGCCACGCAAGACCCCGAGAAGCAACGCGCGTTGCGTGAGGTGGTCGTGAAGGAGACCATCCCTCAGTACCTTGG
TGGGCTTGACAAGCGCGTGGCTGGCTGGGCCAAGCCGTACGCTACCGGCGAGAAGCTCACGATCGCGGATCTTGCTATCTAC