Description :
From Genome Similarity Track
Location :
Scaffold_304:3- 1081
Sequence
1078 bases(100 bases per row)
GATTGGCGGAGCCACTCACTTCAGATGGTAGAGACACGTTGATCTCGTCACCAGTGTGGTTTCCCCAAGTAGGAACCATCATTCACATGTCTAGAGTACT
CTCGTGCATAATCACGCCGAATCTCAATGATTGCGAGCGATCAACACTCAACTCAGACACAGATTGCTCTGACATCAGACGATGACGTCAACTGTGCATG
TGGGATCACTTTTATGTGTTTCACCCAATATCTTCGCACCCACAATGCACTTCCACAAGGTGGCGTGTGACACACACAAAGAGCCACCTTGCATGTAATG
GCAGCCTTAGCCCATTACAGAATCTCCGCGGTACTTCAAGTTCAAGTTCCCAGCAGATCCCCTGGGCTCAATTTCAGTGTACCCAAGGTTTTATATATCA
GATTCATAGGTTTTATTTCTGCATGTGTAGGTTTTAGTTGTAAAACCTGTAGGAGCCCTAGTGGTGTTTCATATGTAGTGTCAGGAACCATAAGCTCATT
TCAATTCAGTTGCATTTTTGCCAAGTTCCTCTCAAGTCTCCCTCTCAAGCGCAAGCGTGCGTGCCGTGTTTGGGGCTGTCTCGGATAGCCTCTCACACCT
GGTAGCACTTCGTAGTCCTTCCAACGACCAAGTCAAGAGTCTGCATAGGCCGCTTGTGTAGCGTGCGCGGACGCTCCAAGACCCCTGTCCGATTGTGAGA
AACAATGGAAGGGATGAAGATGTCGATGGGCTCAATGCCTGCAGAGCCTGTGAAGCTGACGAATGAGCATTTTCCTCATTTGTCGAGTCACAAGTGGGCA
GCCCTCGAGCGTATGCGAGCAGTCATCGGTGAGGCAGCTGTAATCAGCTTGCTGAGAGCGTCTGAGCCCCCTGATGAGACCGACGTGCTTCCGGACTGAG
AGAAGAATCCACAGTAGCGTCATGGTAGCGCTTCAGCAAACCCACGTAGAACACGGTGCGTTGTCATTCTCGTTGGGAAATCGAGCTTGTAATTCAAGTC
TCTAACCTTCTCCACAACTGTGTACGGCCCGATGAATCGTGGCAACAACTTGCTCCCGCTGGGGAGCGTTGTGACTGC