Description :
From Genome Similarity Track
Location :
Scaffold_947:3- 1078
Sequence
1075 bases(100 bases per row)
ATCAACAGTCTCGGGTGGCACAGTTTGGTGGGCATCTCCTACGGCTTGCTGAGCACTGTCTAGTAGGAGCGTAGGTATGGCAGGAATATATATAGTTATA
TATGGCGATATTTTCTGAAACAGACGCCTATATGAGATCAAATATACTAGAAgtggtaaaaaaaaaatcataCAGCATGTAGTATGAGTTATTTCCTGTA
GTGTAGTATAATCTGATTATTCATCTAGTATTTTTTCTGTAGTTCTTGTGCACACGAGGCACGGCATTACTGTATTGTATCATACAACTCAGCAATTTGT
ATGTACTGTATATTTACGCTCTATGTATTGAACAATACTACAGTCGAGTATGTATTATACTGTATATTCGAAGTGCACAGTACAGATTAAATTAGATGGA
GTTGGTAGATGAAGTCTTCACTTTATGTGTCGAGGTGCCCGAGATTGCCTCTCGAGGTCACCCGTGTGGTtgcccacgtctgcttgaccagagcagttgt
cgacTTTATTTCTtagattccggaatgagctcgtTCGCTCAGCCTATTGCTAGCCTCTTACATGCATTCACAGCTATTCACAGCTTCATGGGTTCACTAC
CGCTAGCTGCCTTCCTGTGGTATCTCCTTTCGATTCGCTACCGCCGGTGTTGCTCGAAACCCTGTCActcgatcaacttgttgctaCTCTCTGCCCTTAC
agtagcttgcagcaacaatcatcacttgcactcaatcgCCTCGCGAGACTCCACAAGAATCTCGTGACATTGGAGGTCTTGATCTGGACTCGAGTAATAG
AAGGCAAATACCGAAGTGAGCATTATAGGGTTAGTGACTCTGTCCTACCTGTTCCCTGCTAACCTACGATGCTTGTTATGCCTCACTTATTCTTCCCTGC
GCTTCCCCCCACGCTTAGGAATGTGCCGCTTCCTCCCGTTGCTACCATGACTGCCAGCGCTATCAACTCATGAGTCCGGGTCGTCCGTCGCAGCGCGCAT
TGGAGGCGCTCCAGTTCAACAAGAGGTTATTACGTAAAATGTACAAAGGACAACGCAGGAGGTAAAGAGACAGCC