Description :
From Genome Similarity Track
Location :
Scaffold_867:3- 1027
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G015266Similar to ABCA2: ATP-binding cassette sub-family A member 2 (Homo sapiens)

Sequence
1024 bases(100 bases per row)
GCACTCGATCTGCTGAGTCAGATGTCGAAGCCACTGAGCGTCGCACTGCCGCTCGATGGCACAACGTCGCCCGTGAGCATCTCATCGTCGTTGTCTTGCC
CGCACCGTTAATACCGAGGAATCCAAAACATTCGCCGCGCTTCAGCCCAAACGACAGGTTGCGGACAGCAGCCTTTCCGCCCTTGTACACCTTGCGCAGG
TTGTGCAGCTTGATCATGTCGCCGTCTGCAGCGCCAGAAGCCACTCGCTGCGCTTCTTTCTCGACGTCAATGTCATCCACGTGATTCTCGTCGTCCACGC
TGTGATCTCCAGCAGTCATGTTCTTGATTTGTGGGAATGTCAACGCGTAGTCAATGCCAACAGCTAGTGCTCCAAAGATGATAGTCGTCAACACGAGGTA
AATTAACTCGAAACCCATGACGTCGGTACTAAAAGGATCGTTTTTCTTCCCTGTGCTCTGGCTAACAGCCTTAGCTTCGGCCATAACCAGATTCATCAAC
CCATTGCCGAGGTTGAAAAGTGGAGAGAAGCGCCAAAGAAAGAGAAGGGCGTTGTTGGCCGATTGGGTCGATTTGACCGTATCAAGAATGAACGATACCA
CTAAGAGCACAACGCCAATCAGAAAGTTGATCATGATCGTGTACGTTTGAGCCGACGCATGCTCTCTGAACATGTACGACATGCAGTACGTGAACGGACA
GATGGCGAGACCAAAGAGAAGGAAGAGCAAGATCACAGCTGGGAAGGTCGACGACGTGCAAGACGCGCAATCGCTACTACCAGTCAGCGCAGCAATATCA
AACAGCTTGATCAGGATAATGGCAGAAGCAAACGGCACGATGTAAATCATCAAGTCCCACAAGTAGTTGGACAGCCAGAAAGCTGGAAGAGATACACCCG
AGACCAACTGCTGATGCTTCGAGTTATGCTCTGGTTGACGCTCTTTGACCAAGAACGTTACGATCGATGCTGGGAAGTAGGAGAACGCGATGACAATCAA
CGTGCACGACGAAAACGCCATAAA