Description :
From Genome Similarity Track
Location :
Scaffold_1124:3- 1006
Transcript NameFunction/comments
Pytar_ATCC12531snap-par_contig_1124-abinit-gene-0.18RAC family serine/threonine-protein kinase

Sequence
1003 bases(100 bases per row)
GGCGGCGGTGGTGGTGGTGACTCGCACGCCGGGTGGAGCTCATGGACGAGGTGGTCGACTTCGACAAGCGCGTCCGGGTCTTCACAAAAGTACGTAAAGT
CTTTGAACGTCGGGTCCTGCACGGGAGGCGCCGCCTTGCGGCTGCCTCGGCTCGAGACAAGGGACAAGAAGCCCTTAGTTCGTGACTTGTCGGTCGGTGA
CTGCACTTCGCGATGTGCATCCATATCAGTGAACTCGGCATCGACATACTCCACGTCCAGGGGTGACGTCTACAGAACAAAGAACGTTAGAAACCTGGGA
GAGCAGTACGGCAAGAGAGAGAGAGGGCATGAGACGTACGAGTGAGGGTTTCCACGGCGGTGTGATCTTTCGTTGCAGCAGGAGGTCCCAGTCAATGTCA
CGGAAGAACGCGTGCTCCAGAATGTCACTAATGTTGATGCCCAGTCGCTTGGTCGAGTCTTTTTGCAGAAACTAAAAACACAAGACAAGGCGTTTAGCCG
CGAGTCGCCCCACGCACAAGAACAAGATGCCGCCGAACGTACCCCAATGAGAATATCCTTGAGCTCTGGTGCGAGCTCCGGTTTGTCCGGGAACGTGAGC
GGCTCGTGCTGGATCTTGTGGTACATTTTCTCAATGTTGCTATCGTAGAACGGCGACTTGCCGACGCTCATCTCGTACAACAAGATTCCAAGACTCCACC
AGTCGGCGGCCTTGCCGTACGATCGCTTTGCCTTGGGCAGCAGCAGTTCCGGTGCCGTGTACTGCGGCGAGCCGGCCATGGTTTTTGCACCATTGTAGTT
TGACACGTGCAGCTTCGCCAGTCCGAAATCCACGAGCGCGATGTGGCCGTCGCCGTCAATCATGACGTTTTCCGGTTTAATGTCGCGGTACAAAATGTCG
TGCTGGTGCAAGTGGTGGATGCCGAGCACGAGCTCGGCCGTGTAAAAGTGCGCGCGTGGCGCCGGTATCCGGCAGCTCGAGCCTTTGCTCATGTGGTGGA
ACA