Description :
From Genome Similarity Track
Location :
Scaffold_224:29994- 36557
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_224-snap-gene-0.32Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_224-snap-gene-0.22Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_224-snap-gene-0.23WD repeat protein 6.

Sequence
6563 bases(100 bases per row)
GCCGCGACGGTGATGGTGTCGTTGGGAACAGATTCGGGTTCGATTTCCTCCATGTCACCTTCAGAGGCTTCGTGTTCACTTTCCGTTGTCTctCGAACTC
GGCTACAGAAGAAGACACAGTCAGTTCCAGCACATGCGATTCTACACGCGCTaTTGCGTACGTAGTGGACATTCGACGCACACTCTTGGTTCGCGAGTCT
GGCGCTTCACTACaTTGCATGGACTCATCAGCACATCGAAGATCCTCGCCCTAAGCTAAAGATTACGAACCGCGAAGAGTTTGAGGTATGCTTGGTTTGT
CTGTGGCAGAGCAAAGTCAGAGGTCTGCAACCAGAGTCGTTGAGCTGTGATACTCTTACCGTCCTGCTCGGGTTGATTCAAGCTCCTTCAGCACGAGTTC
ATTCACACTTCCGATCGAGACCGTCGTGCCATTGTCCAGATTCTTGATGGAGAAAGAGTGCTCCATGACTTCAGTGGGCACACGGAGCGGTGTAGGCTCG
TACTTCTCATAGAATATCCGGTAGAGCGACGGGCGGTGGAGAGTCTCTGAGTCGAGCGTAATGGTTCCCATTTCGCCTGGAGGAATCGAAAAGTTCTTCG
AAACTTGGAGCCACAATGCGACGTCTGAGTTCATGTCCACTACACGGATGCGGTCGAGTAAACTGTGACCACTAGGTGCCTGAAAAGCCACGCGGAGTGG
CTTGCCGAGATCACAGTGCTACACATTGGGGGgACAATCTGTAAGCCCACCACAGGCTGTTGAAGTGACCAGTGATTAAAACGTACCGATCGACACTTGA
CAGCGTAGCCACCGCGCTCGGCCTGACGTCGGAAGTAGTCCCAGCACTCTTTGACATTCTTCTCGTGTTGCATCTGCTCGGTGTGTTGAAGCAGACTCTT
TGCTTTGACCACCTTGGGGATCACAAAGTCTTCaGGACCGTAGCCGTACGGGTTGTACTCGATTCTCGCGCCACTATCAGACAGTAGgAaGTCAGTACCG
CGCAATCaTAGTGCCTCGTGAGTGcATCACTTACCGTCGTACCAGCTCCTTtGCAACATCCAGAGCACCCGAAGCACtgATCGCAAACCCGAAAAGTGTT
AGTGGCAACAACGAAACGAAAGCAACGAGCACCAGCTCCTCACCAGGCATAGTGGAGACAATTCCAGCCGAGCTGATCTGCATGATTGATATCGCATCCT
GCATCCGCAAGGATCACGACAATTGGCAGTCGCGCGTCCGTATCGCATTTGGTTGCAAGCCTGCAGCCATCATCACATCATGTTAGTCAGTCCTAGCATC
TTCACGTCCATACGCGTAACGCACATGATCAGGTTGCGCTGGCGACTGTCGATAAAGCGCACCAGAACGCCTCGCTCAATAGCCACACGTACGCCCTCAA
CAGACCCGCGGCGGATAGCGTGGATCAACGTCTTGAGCAGCGCGGCCTGCACGAGACGAGAGATCTTGGCATTCGACCGGATGTAATGCTGCACACTCCA
CTGGCGGTTACCCGACGGCGGCGCGCCACTGCCCATGCGCGGAGGTGCCATCGAACCCACTGTACTATGCGGCACAGCAGTGGTCGACGCCGCCCTGGCA
GCTGCCGTTTCGGCCGCTACCTCCTTTGCGACGGAGGCGCCTTCGCCGCGTGCACTCGTGGCATGGCGCTTGGAAGCAGGTGCTGCAGCTACCGGAGGCA
CAAGCGGAGGCAGCGACGTCGGCGGCGTCGGTGCCACAGGCACGTCATCCTCTCGCGCGTCCTCCGCGTCCTTCTCCTCTTCCTCCTCCCGGCCAACTGC
TCGTCGGTGCTCCCCGCCCTGCTCTTCTCCTGCGGCGTCTCCGTCGCGTCCATGCTCACGCCcACCACGTTGCCCTCCGTCTCGAGTGCCTCCACACTCA
CAGGCGTCGCCACGGCCGCGCAGTCTGCAGCCATTGCTCCGCAGACGCAGACGTCCGTCTGGGGCTGATGGGGTCTGAtGGCGGCGTTGATGACGCCAAG
GCTTTGTCTCCGATCGTGGGTAAAGTGCAGAGCGCCTTGTAACAGATGGAATCGCAGTACAGTATGTACGCCAATCGCACATCCCCAACACACCCCcGgC
AAAAAAaGCCGTTTCTGCTCCGGATCTTCACTGAGTTATGTTCGtATCGATGACaGGATATCGGTTATGTACCCATGTGTTCGAATCCAGCTCTTGCTCC
AAGAGCTgcATGCacTAGCGTCATGCTGAACGCTTCCTGTCCTTTGCCTTCGAGAACACGCGCGGCATGgATCCCTTGCCTGCTAGAACGACGCGCGCAA
TCCACACGTCTTAGCGGGCTATTTCCGAAGCCACACTGTCGCATCCGGATGGCTATTGTCGGACAACTGACTCCATTGTCATCATTCTCATGGGCCATGC
GGGTATGTGCCGCTGTCGCTGTGTCTACTGCAGCTCGAGCTGCAAGCTCTCCTCAGAAAGCTAaGATATTCATGGCCTTGATAAGTTCCTTTACGTAGGG
GGAAGGGTCGGTCGGTCAATGCTCCGGAGCATCTCGAGTTGAGAAGCTGTAGCTCGGCGCACACTGCATCTCACAAACTCATTGACAGGCATTGCGCCAA
TTGATATGGACCCTCATAGTAGCGAAGAAGATCCTTTTACCTCGTACATTGCATGTGGACCAAATTGCTCCGCCCCGAAGTTGATTGTTGCGGTCGTACG
AGCTGAGAAGGAAGAAGGCACCAACAAGACGCTATACGTGATCAAACTATCACTCCTGGACACGGAaTTGGCCTGGACCGTTAAGCGACGCTACTCTGAG
TTCCTTCAAGTACGCGACGATGTATACTTCGCGTTTCTAGGCATGAACGTCAACCAGTGCTTCGGGTGTCGCTGGTTCTCCCAGTCACTGCGAGATTTTG
ACTTCCCTCGCAAACATCTGATATCTTCCAAAGAACCGAGTGTAATCCGCCATCGGAAGAACCGCCTTGATCGCTTtGCACGCCTTCTTGCTGCTCACAC
TTTCTCAGCTAttcccAAGTGTATCCGCTGCAGCGAGATGCCGTTCTACCGCGTGCGCGAGTTCTTCATGCAGAATACGTtGTTACCATCCCACATCTCA
aTCAGTGAGTTGCGAAGGGCGCTTGTACCTCGTCGCTTCGCAGCGATTtCGGATCCAACCAAGAGCAAAatcGAGTTCCGCCGTGGCCACGGCATCTTtC
GAGTCGTGCAAATGGAGAAACCTGTGTACCTTCAGCATCAAGAGTTCGAAGAGGCCGAACGAGCGAAGCGTCTCCAACGACGCTGCGCGTCGTGCTCATG
CGTCAGCGCTTCTCATGGTAGTGATGCCACGCTTCACGAGGGCGAAGAGGCTGGCGGTGATGTCGACTAcGATGAAGAGAAGCCTGCCGTCCACACTCGG
GATGAGGATCACAAATGCACTGTGGAGATACAAGCCAGCACAACCGCCGgGTCCCTCCTGCCTCTACGCAAGCACGACGCTTTCGACACAAGTCAGCATG
GTGAAACCAGACATTGGGAGCCAGCATCTCCCAAGCATATCGGCACGGCCGCCAAGGAGGCGTAACAGTTAGGGCAATGCGTAAAAGCGATCATTCATGA
ACCCATGTGTCTCATCAAGATGGCTACACTTGGTGACTTTtGCACCGGTTTTtACCGGTATCCGACTGCCCTGCTGGATGGTTGCCAAGCCAACCGCGGC
AGAATGACCATGGCGACAATGATGGCGACGGAGGCGGCCTCGCCTGCGCCGTACGCCAAGCAGGAGTACGTTGGCGCTGTGACGCTGCTGCACTTCTCGC
GCGACGGGTCTGTCCTCTTTGTCGGCGTTGGCGCGGTGTTGTACGTaTACGaGACGTCGACAGGgCgCCTCATCACGAGTTACTCGGTGTTTGCTCgTGG
gATCCTACATGGACTCGACTACGGTGCGCCACATTcACCCCATGATGAATACAGAGACACTGACTCACCAATTCGTGCTTGTGGATCACAGTGTCGACAG
GAGCAaCGCGGAATTGGgCGGtGTTTTTCGGCCAGAAGCGACTGCAGTGTGTCCGCAATCTTCCCGAcTCAGTGCCTGATGCACTGGCACAGCAGCAGTT
GCAACGTGTGGCCAAGGCGAAGGTGTGCTCAGATTGGGTCTTCGACGTGCAGATCCTCTCGGGAGACAGCGTCCAGAGTGGCGAGTTTCCTGTTGTCGtc
GTTGGATTGGCGCACAACTTCATTCAGTTTTGGGACCCCAACATGGATGCGCTTCTCCGCACTGTCATCTGCTCGGAGCGGTGCATTCTCTACTCGCTTT
CCTTCTACGGTCGTCGTGAgAAaGACTTGCTTGTAGCATCGGGTACAGTGTTTCAACAGGTGCTCCTGTGGAGTGCAGAGAAGAACAAGGACCGaGCGGA
CCCTCAACAGCGTCTCCACGGGCACGATGGTGTCATTTTCAAACTGGAGTGGTCGAGaGATGCGCGTATGCTGGCGTCTGTTTCTGATGATCGCACGGTT
CAATTATGGACAAACTACGCTGATGCAatCGAGATGGcGGTAGATTCCGAGGCTTTCtGTGCCTCCCACTGGCTATCGCGACCCTGGACCTCACGCTTCC
GATCGTGGGGCCACACAGCCCGACTTTGGGATGTCCGATTCTTCGCGTCTCAAGTCGTGACGACGAGTGAAGATGGCATGTGCAAGGTCTGGACTCAGAA
TGGCGAGTGCGTGGCGACACTGCAGGGCCACTCGGGTAAGCACGTGTGGCGTGTTGTAGTGCATCCATCCAACGCTCTTTTGGCCACGGGCGGTGGTGAT
GGTGCTGTCAAATTGTGGGATATTGAACAGCAAGTGGTATCCACAATCACTAGTGCTGGAGCCAACTGTGCGgTCCATATCTTGAACCAACCGACGGCAC
AGGACGCGGCATCGACAGTGACAATCTCAAAAAAGAAAaCTCCAAGTGTCAGCATTCGCGACATTGTCATCAAGCGAGGCAGCAACGATGATGGGAgTGA
CGCGAGAGGCTTTGtGGCCGTTGAAGaCGGACGAGTCTATGAACTGAGCTTGCTCGACCCTAGCAGTTCCTCGCTCACATTCTCGTTCTCCGATAAAGCT
GGATCTGCGTCGACACAGAGGCCAAACATTTCAAGCTTCGCCCTGGACGAAGAGCAgAGACACTCCCTCATTGGCGACTCGAGTGGCAGTGTTCTAATCG
TTGACACTACGTCGCTTTCGGTCCGCGCTATCTGGAAAGCACATGCGTCGAGAATTATGAAAGTGTGGTGGGACGAACGCACGCACGGGACGCTCATTAC
ATGTGCAGCGGATGGTGGTGTGCGTGAATGGCGTGTGCCGCACGATGCAGAGCCGGTTCTTGTGGGCAATTTCAGTGGCCCAGCAAAGTGTGCGACGTCT
GCTGTCACCATTCTTGACGTATCTACGAGCCGCAACATTATCTGTGGCGATGCCCGCGCGAATCTCTTCGTTTTCTCGCGACTTCTTGATGCAGTTGATC
CAATTGACCCTGACCAAGAGCCATCCGCGCCTTCTTCAGTTTTGAGGGGCGTCCACGGGCGTGATATGATCGCGACGTTGGTTTATCAGGATCGCATCCT
GTACTCGGGCGGGCACGATGGCTACATTTGTTCCTTCcTCATCAATTCATCTGCCAGCGATGAGGgACGCATCTCGCTCCACTATGTTGGCCGAGAATCA
ATCAAGGGGATCACAACCGTCAAGCAGCTGTGGTTCGAGACCACTTTGCATGGACAAGAGCTCATGGTGTTTGGCTTCCATGCCACTCATGCCGTGCTCT
TCAATTTCTCGGCTCAGTACCGCTTATTCAATGTTGAATGCGGTGGCTGGCGCCGGCCTCACGCCCTTTTGACTACGCCTTCGTCGTCGTCTGCGATCCC
TCGTCACTCGTTCATCTTCACGCCCGTTaCAAAAACTCCCGACTTGCAAGTGCAGATCCACTCGACTGTGGGGTTGAGCTCCGTACCCGTAGCTCGTGTC
TCGTTGCACCACCAGTTCCATGGTCGTATTGCTACGTGCGTTCGACTTCtCGGTCAAGATCaTCTCGTCACGGCAGGCGAGGACAACTGCCTCAAACTGC
ATCGACGTTTGCCTGTGCCTTtcGTGGCCGATGCCTCGCCGTCTCACCGCTGGACGTGCGTGTCGACTGGCATTGCCCACACGACCACCATTCGTGCACT
CACTTCGTTCTACGTCGCATCTCAGAAGGCCCACGTGATTCTATCGGGAGGCGGCAAGCAGCGTCTGAACGCaTGGCGAGTACACGACGACCTCGATGTG
ATTGAGTTCCTTTGTGGCCAGGAGATGTCGGATGCTGATCAAGATCACCGCATTCTCGGTCTCACTACATTTGCTTTGCCGTCTTCAGACACGCAGCGTC
TCATCGTCGCCTGTAACTCGGAGGGCGCGATTCAGATCCTGCTTCTTGATCTCGGAGACGGCGGGGCctCACCAAAACTCCAGGAACTGGGCCagTGTTC
ATCGTCAAtGAAGCCGATTTTGAGTTGTGATGGTTGGCAGCGTGATGGCGAGCACAGGGCCGT