Description :
From Genome Similarity Track
Location :
Scaffold_843:2999- 12762
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_843-snap-gene-0.5Dynein heavy chain

Sequence
9763 bases(100 bases per row)
TGTTAGTTGTCGTCCTGGAAAAGGATCGCGACACCGCGAAGCACCCACTTCTCTCGCCCGCAGTCTGTGGGCAGCGTCGCGAGGAAGACGTAGGTCGGGC
CACGGAATCGCGTGAGGTAGACGGGGCACTCGTACGTCATCGGGTCATGCCGGAGGTATCCGACCGAGGTCGGCTCCCAGCTCGGCTTGGTCTGCACGGC
CTTGATGTAGACAATCGGCATGGGCCACAACAGCTCCTTGGGGTTGCTATCCAAGATTGTGCCACCGCACTCGGTCGATGGGGCCACACCAACTTGGTAT
TTCTCGGTGATCTCGTCGGGCGTCGACCACCGCGCACCTTCGAGAATCAGGCCATGGGCAAACACGCCGTCGTCCGGATAGCACGTGACGGCCGACGGAT
CCTGGAACGTGGTCACGTGCGTCTCGACCGTCATTTGGTTGAGCGGCATGAACTTTTTGCGGGACGTCACTTGGAGACACGCCGTCGTATACGCTGTGGG
GTTGAAGAGCCCGGGCAGCCAGATCGAAAAGGGCGTGACAAAGTCGGTCGTCCACTTGAGGAGCTGCTCGTACCGCTTGACCATGTCGACAAACCAGCCG
CTGAGCGATTTCTTGGACGGCCACGCCTTCTTCTCCCACTTGCACTGAGAGAACGGATTCCGCCCGGGCACTTCGTTCAAGCTCATCGCGGTCGCGAGGT
CTTCCATGGCCTGGGACATGTTGAGCTGGCCGTTTAGCCCCTTTTTGAGATCACCCAATGACGAGCGGATCTCCTCGAGCAGCTCATTCATACGCGCACA
CTCTTGGAGCGCGACGACGACAAACGGGCCGTGTTCTTCCGTGAGCAGGGGTGTGGCCGTCTCAGTGATGTCGAGCATCGCAAAATGGCTCGGGCACCGC
GCTTCAAAGTCGTCGATCGCCACACGCAACACTGACGTCTTGTCGTTCCCACCGCCTTCTCCACCGCCGCCGCCGCCACCTCCGACAGTCACGATCGTAT
AGCACAGCGTCTCGCAGGTCGTCGTCAAGTAGCCAATCTCAGCGTTTGGGTGGAGACCAAACAACGGCGGCGACTCGGGCACCATACTCTTTTCGATATA
GTTGGCATAGTCGGCAAACGCGAAGTCGTTGGCGTTGGGCGACTTGAAGCCAGGCCCCAGCTCCATGCCGTTGAGCAGTCCGGGGTTAATGAGCACGGTG
AGGTACGTATTGTTAGTGCGGCGGTCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAAATGTACCGC
AGATCGTCCCACGGCACGTTGATGTTGTTGTCCAAGTACGAGTGGAGAATGTTAGCGCAGATTGTGAGGTCACCCGTGTTGAACGAGTAGGCGCGCGACC
AGCCCTGCTGGCCAAACCGCTTGCGGCCCAGCACGATCGCGTGGAACCAGCAGAGCGCAAACAGGCACGACTTGAACTCAGACGGCTTGGTGCACGCCTG
CACGCGGTCTTCCGCAAAATTGGCCCACGCACGCCGCAGATTTGACTGGATATCGGACGGCGCCTCGTTGGCCACTTTGATACAGCTCTGCATGAGTGAC
TCGGGAATGTTGAGCATGTCGGGCAGCGGCGGTGGTTCGGCCGAGATAAAGCACCGGAAACTCTCGTGGGCGCCCTCAGTCGCGACTTCCTCAAGCTGTC
GCTCGAGCGTCGGCAGCCACGACTGCATCAAGTGGACATTTTGGAGGATGATCCACCCGCCTTCAGTGCTGAGCCGCTTGACAGCATCGCCTGCATAGGC
CTCTTGGCCCTGGCCCATGGAAATGTTGATAAATTTGCCATTCTCCACACTCACGCCTTTGGATTTGCCTAGGTTCTCGACCCACGGCGTCGGATCGACA
CCGGGAAAGAGCACGAAAAAGATTGGGATCGACGAATTGGTCTCGTCATACGTCGCCTCCACGTTGAACGGCGGTTGTGTGACGTATTCCTCTCCAAGCG
ACTCCAAGATGAACGTCCGCAGCGCATTTGTCACGCGGTCGGGTCGCATCGCCCGCAGCAATATGATCCGTTGGAAAGACGTGAGCTTGACGAAATCGCC
GGGAAGCTTTTGCCGCTCGGCGTCTTCCGTGGCAAACCACTTGCGCCATTCGTCGGGCTCGTTTTGGACGGAATCGGGCAGCGCCGCAAAACACTTCATG
GTCTCCAACGCCTTGATTTTGGACCAGATTGCGACAGGTAGCCAGTCCGACGCCGAGCCAGCATTGCCCGCGTCTGCGTGGGCCTTGCTGATGAGCAGTG
CCTCGACCTCGCTGTCGAGCAGCAGACCGTCTTTGAGCAGGATCTTGAGGCAAAGCATGGTCGCGACCGTAAGCTTATCACGTTCAAAGACGCCACGTCG
CACATAGTTGTACACACACGACGTGATGCTGGCCATGAGCACGCAACATCGCACCGCCATTTCTTCATTGCTGAGATCCAAAGCGGATTCGTCTGCCTCG
CCACCTCCGACACCGTTGGCGTCCTCTCCTTCTGCCGCACCGCCCGCTGGACTAGCGGCTTCAGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNGCCGCACCAGCGCTGCTTTCCTCTCGCAGGATCGGCACGCGCGAAATGCCCGACAAGAAGACTTGCTGGAACGACGCGAGCGAGTAGATGTAG
TACGAGTGCACTTTGCTAATGTCGCTCATGAGGAAAAACAGTAGCGAGCCGCGCGCAGCAATGCTGCGGTACTTTTCACTGGTCAGATTGACGCTCACCT
GGGTCATCTTGGCGATCTCCATATTGTTTTGAATGCGCTGGGCCTTGAATTTTGTGTCACTGAGGATAGTGATGAGCGGCTGGTTGTTCGTAATGTCGTC
GTCGGCATTCGCGAGCTCCGACAGGATCACATCCTCTAGCCGATTCAGCTCGATCTTGCCCTCGTTCTGTTCTTGAATGAGTCGCTCGCGCTTAACCGCG
AGATCCGCTCGCTCCTTGGAGACCACCAAATTCAGGAGCTGGTCCTCAAGCCCGAGCATCGTGACGGTAAAATTCACGATCGTACACTCGGCCTGGATCT
CCGGAGGGTAATGCGGATTGCCCAACTTGGTGTGCAGGTAGAGCCGAAAGTTGTCATTGTACGGCACGGACGCGTCGCCGATCTGGATCTCGTACCGCGC
ACCTCGGCGAGACGTGGACCTCTGGATCACCGGCGCCAAGATCGGATCGATTTTCTCGCCTAAGTTCTCAATTAGAAAGGCACCGTCCATGCCAATCGCG
GTCTTGAGACGCTCGATCCACATCTTTTGGCCGACGCGCACGACGATTAGACTCTTGGCCTCCATCTCACGGATCCACGCGATGGCTTGCAACTGAGGGT
CAATGATGAGCGGTCGTCGCCCCATCATAACGGTCGTACACACAATAGCGCCGTTCTCGGTGGACACGCGATCGGCTGGCAATCGCTGGGTGTTCCACTC
GGCGATTTGCGCGTCATTCGTCAAAATCGAGAGCGGGTTGGCGTCCTCGGACATGGCAATACTCTCGCCGTTTGAGGCCTTACGCAAGTACGGCACCCAG
TGTTTGTTGATCAGTTCGTCGCGAAACGGCTTGGTAAAGGGACCAATGTACGAGATGAACGCCGACGCGAGCAGCACATCGCCGACCAATAGATCTTTTT
CTTGCTGGAGCTTCTCGACGTTGATTGCCCACCGCACGTTTTCGCTTGATAGATCGTTGGTCAATTTGCCTGCGAGCTTCATCTTGCGGTTGCCCTGCTC
GACCGAACTGATCGCGTCTTCCTTTTCGCGCTCGGCCGCGGCGGCTTCCGCCAGGAGCTTGTCCAGCTTTTCTTGGAGCTCGGCGACCATTTGGGTCACC
TCGGCGAGCCGCGTGTTGGCAGATTCCAACTCGGCGTTGGCCGCAGCGAGTGCCTGGCGCTTGGGCTCAACCGTCACGAGGATATCATAGTACATGACAA
TGTTGACGACCCACGAGCAGAGCCCCGCGGCGGCCTTGTTCTTGGTCAAGATAATGTCATAGTTGAAATGCTCCTTCTCCAGAAACTCGCGCACTTCCTT
CCAATTCACGACCGGCACTTTGCCTTCGTCCACGACCTGCTTAAAGTTCGTCAGATAGTCGATGTACTCGGGAATGTTACCCAGCAACTGTTTCTTGACT
GTGTCCCATTTCGTGTCTTTGACTTTGCCCGTCTTGGAGATTTGCACATTGGGATGGACACCGGCGAGCAGCACCATGGTCGCGGCGAAAATGTCGTCGA
CGCCCGCTGGCGGCTTGGACATGGTCTTGCACTCCCCGAGATCCTTCTTGTTGAGCGAGTCGAGCGCCTCCATGGCCTGCTGCACAGCCGGCTCGGCCTT
GGCCAAGTCTTCTTGCGTCGAGCGCTGCTTCTCTGTGACTTCGGCCTGGATGATCGCGCACTTGGCGGCCTCGTCGCTGGCCTTCTTGCTCTCGATTTCG
ACGTTGGCTTTTTCCTTGTTCACGGCTTCGGCGATGCTCGACGAGACGGCCTTCTTGTCCTCGGCGGCTTCCAGTTTGCCTTTCAGCTCAACCTCCAATC
GCGCCACGGTCTCACCAGTCTCTTTCAGTTTCTGGAGACCTTTGTCTAATCGGTCAATCGCGGCGCTGTACTCCTTGAATTTCTTGTGGAGAATCTTCTT
GTACAGCTGCAGCAGTTCGAGATACGACTTGGGCGTCGTGTAGACGTACCGTCGTTCCACCTGGAAGAACCTCTCAGCACACTGGTTGACGGACTGCACC
GAGAACGGCATAAAGTTTTCAATACCCGTCCGCGTGTTGTCGTCACCGAGCAGGTCGGCGATCTCCTTGAGCTTTTCTCGGCCCACAGAGAGAAGAGCCT
CCTTGGGCCACGGCTGGAACCAGTCGATCACAGTACAGTTGACTAGCGCAGGGAATTTCCGTGCTCGGTTTCGGAAGTCGTCGCCGACCGGAGAGAAGCA
GAGACAGAGATGGAGCCGCTTGCGGATCTCGCCCTGGAAAAACTTGATGACTTCTTTCCGGTCTTTGGAGCCGGCTACGGGCGACAGCAGGTTCACGATC
GTGTCCATGTCTTCCATTGCAAACAGATCCGGGATCTCACCCGACGCTAACAGATCGTTGAGATAGATGAGAAACTTCTCGTTTGTGATCTGCGAGTCGG
TGAGCATGAACACGACGCCGCCTTCTTCTTCATTTCGGGACAGCATGTCGACCACGGCCATGTGCATTTTCCGCAAGTCTTCTTTGAACTCGTTCTCGCC
GTACTTGGAACTGATCGTGATTTGCCGAACCGTGCACTGGCAAATGTGACTCGCGAGACGCGCGAGCGATCGTTTGCCCGAGCCGCCGACACCAACGAGC
AGCGCGTGGCCGCTTTCATTTCGCAGGATGCGTACGATGCGTGCGACGTGCTTGACGGCGTCGTCAAAGAGATCGAGATGCATGGCCGTGTTGTTTTCAT
TGTTGTTGTAGTCGCGCAGCTGTGCCTGCAAGTTGAGCTTGAGATCGTCGAGGTTGGTGCCCGGGATTTGGTCGTACTCGGGGTCGCCGTCCTTTGTAAA
ATGGCAGAAGATGAGAGGCCAGGAGTTCTCAGCCGCGTAGTACCGACTCGTGTTGCATGCCGGGAACGACCGCTTGACTTGGAGCTGCACGAGCTGGTTG
TACTTGTCAATGTCGGCCTTGCACACGAGGCGATCGCCGTATACACGCTCGCTCTCGTGGAGCCAGAGGAAGATGAACTTCTCGGTCGTGGAGAACCGCT
GCTTCTTTGAGGCAATGAGCCCTTGAAAGACGTTGGACAAGTGACGCACGTTAAACTCGTAGTGGAAGTTGGCCGCCGTCTTGCGGAACGTGTTCACGAC
AGAGTTGTGGAGCGCCAACGCGGCCTTGATGAGCGCGTTGGAAAACTGGACGTTGGTGAGCTCGTCGCTGAACGTCGACAAGTGGCCCCCCAAAAACGTC
TCGTAAATGGTCACGAGGCTTGGCGCCTCCGGCATGCCCATGGCGAACGTACAAAAGTGCCGCTGCAGACGAGGGTCAATGAGAAACGACCCAGCGGTCG
GATTCATGCCGGCGACGACCTGGCAGCTCAGAATGTTCTGGTTCTGCAGCTTGGCGCGGTCGAACCAGTGCTTGTACTCCATGACTTGGCGCAGCAGCGA
GATTGCGCTCTGTGTGTTGTATGGATCCACCTCTGGCAAGTTCAGATCGTCCATGAAATAGATGAGCTTGGCCTTTCCGGGCGGCCCCAAGTTCACGCCG
GTCTTGCGCTCGAGCTGCCCAAACATGGCCTGCTGGAGAATGCCCGAGGTCGTGTAAAAGTTGAAGTTGATGGTGCAGTACCGAAACGCCGCCGTGGCTT
CGTCCTTGCTGAGCTTCTTGAGCATACCCACGATGTTTTGCGTCTTGCCCGTGCCTGCAGGGCCGCATACCATGACCGGCACGCTCTTGGTGATGAGACT
CTCGAGCCAGAACGCGATCGACGCCGTCTCCGTCGTGGGCACCGTGATCTGATTGATCGGGCTCGGTGACTTGTAGGTCTCAGTGTAAAAGTACGGCGAC
TTGGCCCACGAGTTGAACTTGGACGTCTCGGGGTCGAGCCAAAAATCGAACACCGTGTTGCTCGCTGACGCGACCAGCTTCACGTCTTTCCACTGGTTCT
TCCACCAGTTGCTAAACTCGGCTGAGTAGTCCGTGCCGTCGTCGCTCATGGTCAAAATCGAGCCAAACGCCCACACGCAGCAAAATACGAACGTGTTCTG
CATGACTGTGAAATCCTCGAGCACCTGGACCGTTAGCAGGCAGTCGATCATGTTGAGCAGGTTGGTCACCAACGTCGTTTCTTCCACAGGCACAATGGGC
ACGAGCTTCTTCTTGAAGAACTTGAGTGTCGGTTCAATGTACTGGTCGAAAAGCCCCTGGAATTTCGCACGCGTTTCCGACGTGAACTGCATCTTCTTGA
GGCGATGGTCAAGCGGCGCTTGCCCATGGACGTTGAGCCACGAGTCAATCAGACAGCGCCACTGGTACCCTTCAGACGTCGAGATGTACAGGATACCGGC
TCGGGAGACCGTTGCCGGTGTGGCGTACACCAAGTCGCGGATCTCAAATATCATACGCATGTGTGTCTTCAGCGGAATGCGCTCGTTGGACGCGAGCGTG
AGCATGCGGTTGTCGTCCATGACTGAGTTCATCGATTCGATCCAGTTGGCGTCCAGATCGCCGTCCAGAATGATCCACTTGGGATTGTTGTCCTCGTCGC
CATTGTCGCGGCGGCGCGAGCCGAGATCCCGCATGATGCGGGACAGCAGACCGTCCTTCCACTCTCGTGTCTTGAGCACAATGTATCCATAGAGCTCGTT
CGTGCTCACCGACTTGGGGTTCAGGTCTTGCACTTCCATGGGCGTGCCCATGATCTCACGGGCCTTCTTGAGCGTCTTCCAGGTCTCGGTTTTCCCAGAG
GACGGAGGACCCATGACAAATACACAGTGGCGAATCGCAAGCAGCTCGGCGAGCTGCACGACCTTGAGCATAAACTCGGGCCGTGGCGAATTGCCAATGG
CCTCGGAAGCGCCCTGCACCATGGACTCGAGCTCCATGTCTCGCTTGCGGGGCGGGTCGTTACGGACGTCGACATTCGGTGAGTCGCGCGGAAAAAGATC
GCCCAGCAGACCAAAGAAAATGACGAGATCCTCAGCGACGATCTTGGGGATGTTAAAGTCGCGCAACGCACGCATGAGCAGATCAATCTCTGGGATGTCG
GGCTCGGCACGCTTGAATGCACCGGCGACACACAGCACTGACTTGACTGCACGCAGCCCCCAGTCGTAGTGGAGCTGCTTGGAGAGCAGCTGCCCAAGCA
GCGAGTATAACCCGTAGAATTTGGACGCGAGAATCTTGGCCTGTGTGAACCCTTCGGCCATCAACATGTTTTCACAGATGAGCACGAGGTCCGGCACCAT
GACCGTCATGGGGCGGAACAACGCCTTGAGTCCTTCTGGTAATTCCGACCGGCCCAAGTACCCGGGGTTCATCGTGATGAACGCGCCGACAGTAGGATCC
AACATGACTTCGTCATTCTCCAGAATGAACTTCTCGTCGTCGGCCTTGCAGGCATCGCACACGGCCTTGAACTGCACGGAACACACGGACAGCACCTCGG
GCACAAGCCGGTTGAACTCGTCAAAGCACCCCCACGAGCCCGACGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGACTCTTAAAGTCC
ATCTCTGGAGAGCAGTTGAACACGTAGCACACTTTGCCCAGCGCGTTCGCAAGATCTTTCGTGGTCTCGGTCTTGCCCGTCCCCGCGGGACCCGCTGGTG
CACAACCCATTTGCAGGTTCAACGCCTGCGTCGCCGTCACGTAGATACGATCGGTCAGTGGCGTGATGACTAGGCGAGGACCGTTGCCCAAGTACTCGTA
GTCGTACGGAATCCCAGCGTCGCAAATCAGAATCTGCGCGCGCGAGTTATTGATGCCTCGGAAATTCATGTCGCGCTTCTTGAACGATCCCTGCACGGGG
GAGAAGTAGTGCTTGAGCTGCGACTGCCACTGGAACGACGTAGCGTCGTCGACGCCCGCGCGAATCATGCTTGCGACGATATCTCGCCCGTGGGCGTCCA
TCGTGATCAGGACCATGACGCGCTGTCGTTCCTCAAATGAAATGTCGCTCTGCGTGAGCTTGATCAGATCCTCGAGCTGCTTTTCTTGGAGCTTGTTGTA
GTTCTTGAGCGCATCCTTGTCGCCGTTCCCGGTCATCGCTCGGAACGCGCGTTCGACTTCCTGGACGTAGTGGACGCCGCCCGCCAACAGAATGATTTGC
GCGGCATCGATGGGCCTCCCCGTCGCCGGGTTGAGCTGGTTGATCCACTCGACACGCGGCATCTCCGTGTACGCGACCAGCGAGCGTTCAATGTGGCGGA
AAAGTGTGAGTCGCATCGCACGCATGACCGTTTCGAGGTAGATCTCGGCCTCGCCGTCCAGCACGGGCGGTTCGTGGAACTCGACGGTCTCTTTGCCGAC
GCCCGATACAAACTGCGTGGCCATGGGGCGCTCTCCCGGTCCACGCTCGACGAGCGTCAGGGTCTTGGTCGCGAGATAGATCTTCGAGCAGTGCACCATG
ATCCGATCTGGGTGGGAGCCGTTGGACAAGATATCGAGCAAATCGGCTTCCGACATGAAGTAGAATCGCGGAAACTGGCGCCGCCGGCCGTCCAAAAACT
CCTTGAGACGATGCTTGCACAGCTCGAGCTTCTCGACGATCTGCTCGAGCTTCTTAATGAGTCCCGGCTCCGTACACGCCACGCGGACATTAAACGTCTG
CCAGGCTTTCTTCAAGATGCGCCGCACATCGACGTCAATGTCCTCAAAGTCGGCAGTGAGTTCGGGCAGCTGCTTCTTGACTTCTTCCGATTGAATGAAT
AATGGCTCCAGATAACTCCACGAGCGTTGGATGTCGCCGATGAGCACGACGACTTCGTTGATGGACGAGAGACCTATTTGTAAACTGGCGACACGTGGCT
CAAACTCCGACTGGTACGGCGACGCGCTCATGCCCTGGACGTCAATCTGGTGAGTCTCGAGCAGCTCAAAGTTTTCCTCCGATACCTTGAGCAAGGGTAC
AATGTCTTCTTCGGCGGCCTGCGGGTTGTACGGAGTCATCTCCCAGTTCACTTCGGCCCAGAG