Description :
From Genome Similarity Track
Location :
Scaffold_47:299882- 302664
Transcript NameFunction/comments
Phyra_80283PREDICTED: LIM domain kinase 1-like

Sequence
2782 bases(100 bases per row)
GATGAGGTGGATGTCGTGCGCAAGGACAGCGACGGCTGGTGGTTCGTCATCAAGGACGGCGAGAAGGGCCTCGTGCCGGGCTCGTACCTGCACATCGAGA
ACCCCATTATCCCCGTCACGGATGCGGCGATCCTCGCGGCACGTGAGACCTCCAATCAGCGGTTCATGGAGATGCAGCAAAGCTCGGGAGCAACTGGACA
GGGTGCCGAGCCGGGAGTGGAATACCAGTCGCCGCTGGGACTCGAAGCGCTCGCGATCGCAGACTCGTGCGCGCCCAAGCCGCCCAATGGGCCTGCCCGC
GCTGATGCCAAGTCTGGCGGCACCGAGTTTAAGCCGGGCGAAGTGCGCAAGTTGAGAAAATGCTACGCCTGCAAGGAGACGATTCTGGGCCGCACGAAAG
TGTGCAAGGACCAGATATTCCACGAAATCGTAAGTGGCAGTGGTCGGCTTGCTTAAAACACAGTGTGTATGCTGATTGCGATGGTGTTTATACAGTGTCT
GCTGTGCAAAGGCTGCCGCGAGTCGATCGAAGAGGGCGAGGACTTCACCCTCATCAAGAAAAAGGTTCACTGCAAGCACTTTCTAGGGAATGCTACTGGC
TGAGCGCTGACCATTGTGTTGGAACTGTAGGCCTACCACGCTGAATGCGCTAAAGACGTCAACCACTGCATGGTTTGCGATAAGGTATTGCTCGCTGCTG
CAAGCGTTTCGGTGTTTTGCGAAAAGTTCTCACGTTGATGCATGATGTAGGAAATCTTGGGCCGAGTGTACCGAGCTGGCGATGGCGCATTCCACAAGCT
TTGCATGGTTTGTTCAGTTTGCAACAAACAAGCTAAAGAAGGTAAGCAACGCCGTTAAACTGGAACTGAAGGATGGTGGAGTGTGCAAGCGGATGAAACT
CAAATTTTGATGTTCACTTACCGTTTGACGTGACAGCTGGATCGAAGTTGGAAAACGACCTCCTCATTTGCGGTGAATGCGTCGCGGAGAAGGGTAAGCG
CATCTTACGGTGCAATGGCGAGTCGAACAATAATGCTAACAACTACAATGTGGCATGCTTGCAGAGAGAAAAGAGAGGGAGGAGAGAGAAGCCGCCCTCG
AACGTGAGCGGGCTGCTGCCAAAGCGAAGGCTGAAAAGGAGGCTGCTCTTGCTGCAGCACGCGCGTTGGAAGAAAAGAAGGAGCGTGAAGCACGCGAAGC
ACAGAAGGCTGTCGAAGACGCTGCGCGCGCAAAGGTTGAGGCAGAAGCCGCTGCGGCTGCGGCTGCTCGTGCCCAGGCTGAGAAGGAGGCAGCAGAGGCG
GAAGCGTTGCAAAAGGCTGCTGCAGCTGCTGTGGCAAACGGCAACGGGCGGTCTGGAACCGACAGTCTGCGATCCAGCACATCAAATCTTGATGAGTTTG
ATTTGGAAGCTACACCCATCGACATGTCGGGTCAGAATAATCGTATCTCGGAAGTATCGGATCTGGACTCGATTCTTAGCGACGGCGATTACGCTGGATA
CATGGGAAGTGGCCAACGGGAGTCGCTACGCTTGTCAGAGGTTCTAGACCTCGAGTCGTATGATGACCGTTTGTCCGACTTGAGCGGCATTTCAGAGGGA
GGTGCTGGTAGACCACGACGCTCCACAATTGAAAGGACCGTGAACGAAAACGCAGAGGCCTTCTCGGAAGATGAAGACGATCGTGAGCTGTGTGGTGGTT
GCGGACTTGTCCTGGAAGGAGAAGCCGTTGGTGCATTGAATCAGTACTTCCACTATGAGGTACGTGTTTGCACACTGTGGAGTTCATCATGTTAGAAATC
GTTTGACGAACAACCTATGCTGCTTGTGCTGAACAGTGCTTCAAATGCAGTCACTGCAGTCGTGTTATTGCGGAAGATGATGGCTATGCAGAGAAAGACA
ACCAGGTACTCTTCTTCTTGAATTTGGTACCATACCCTGCCCTGGAAACTCATCTCACATCTTGCTTTTTGCAGGCTTTCCACCAAGCATGCTACCAGGC
TCGATTCGGAAAGAAGTGCCATCGGTGCAGCAAGGTTCTCAAGGGAAAAGTCGTCAAGGCCCTCGATCATCTCTACCACCCGGATTGCTTTGTGTGCTTC
AATTGTAGTGCTTCTCTTTCAGGTACATACCATAATAGCCCGCTGGATCGTATGTGTGAACTACTCAATACTAACACAGGGCGTGTGTGATGTTTTATCG
TCCAGCAGAGAGTTTCTTCGAGCACGAAGGTCAAGCCGTTTGCGCTAAATGCAAACACGAAGCAATTGCTTTGGACGAACCAAGCCTCCCGTATGTCGTG
TGCTTTCTGCTTTAACTAGCACTGCCTACCAACTAAATTTGTGTCATATGTTTTGCTCTGCAGAGAGAACGTGGCACCAGTGTCTAAAGGCATTGCTGGT
TATCGGTTCGACGCCCAGGATGACACACAATTGACTATTTATCCGGGCGACGAAGTCACTATCCTTCAGAAGGTTTGTTCATTTAGAAGGCGGCTCTTGC
TGTAAACGCTTCCTAACGTTGGCATCTTGCATTGTGTGCGACAGGACGACGATGGCTGGTGGCTTGTGGATTTGCGAAACAAGCGTGGTTACGTGCCAGG
CTCCTACTTGATCGAGCGCCCAATTGAAGAGCCAAAGCCCCAGCCGAAGAAGAAGAAGAGTGCCTTCAAGAGTAAGCCCAAACGTACACCGGGTCTTTGC
AGCTCGTGCTCGACGCAAAACCCGGCGGAGGCACGCTTCTGCCGAAGCTGTGGCAACAACCTGAAGGCCTAACTGGCGGATG