Description :
From Genome Similarity Track
Location :
Scaffold_13:299876- 305480
Sequence
5604 bases(100 bases per row)
CCTGTTACACCTGGTAGCACCTTGTAGTCCGTTCAACGACCATGAATATGTAGGACGATGAGGGGGATGATTTTCATCCCACGCATGAAAGCTACTCCCA
TTTGAGTCAAATCGAATGGGACGCTGTCGAACGCTTGAGTTCAACGACAGGGCAAGAACCCGTTGGCGCACTGCTGTCCGCCCTGGGGCCAGACGGACAG
CACGCCACCATCGCCAAGTTCATTCTGAATGAACTTGGCGCTAAGCGGAAAAAAGTAACCTTGCTTCACCAACAAGGTTCTCATCAGACAGAGCTGTTGA
GAGAACATAGTGATCAACAGTTTGAACTGTTGAGACAGCAGCAGGCCACTGCTACCGGGTCGACGTGTATACGTCGACCCGAGACTCTAAAGATCGACAT
CTTAAAGTACAAGGGAGCCGATGAAGACTCTCTATTGAGATGGTTCGTGGAACTAGACGATGCCATAAGGGCTCGTCATATCTTCGATGAGGAAATACAG
ATCGCATTTGCTCAATCGAACTAGGCAGGGCATGCAAAGACGTGGGCCTTGGGCCTTAAGTTACACGACCCATATGTCTTTGGGTCGTTGGAAGTATTCA
AGTCCCTGCTAAGGCAAAGTTTTGAGCCGCTGCGAGCTGATTTCAGGGCTCGCTCTGAACTTCTGAGAATCAAGCAAGGCAAACGTGACGTACACTCGTA
CATTCAGTACATACGTCACCTTACCAGTTCCATAATAGTCGACCACTGAACCAACAAACGTTGATTACATTGTTCATGCAGGGTCTGACTGATAGTCCTG
TTAAAACCTACCTGATCCGGTTGGAGTTCAACACCCTGGAAGATGCAATAAGGGTTGCGGAACAGGAGGACTTCAGCGTGAAACAGGCTCACGCGAATTT
GAATTCCTATCGTCCGTCGAGACGACAGAAAAATGGAGGCCCAGAACCAATGGACCTCTGTAACGCGAGGAGAGAGAGCTCTCGTGTTAACAATTACAAG
AAATTGCAAAAATGCAACAGATATCAGAAGACAGGGCATTATGCATATGTATGCAGTGCCCCGAGCGCGGTACCACGTACCGCAGGAAACAGTAACCGCC
AAGCGGCCAAGAGAGGTCCAAGGCGTGGGTCCGACGTTGGTGCGAAAACGCAACAACGTAACGGACAGCCAAAAACGGTCAGGGTCAGTAGGTGCNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGACGTTGTGCGAAACGCACAACGTAACGGACAGCAAAAACGGTCAGGGT
CAGTAGGTGCGAGCACCCTAATGATCAGCAACGTCAAGTGAGTTTGCAGGCTCTTGACGAAAGTGCTCCCAACACTCAGTCATTGTGTGTTGCTGCTTCT
GGTAATGAGGTTTCCCTCATTACCTTGAAACTCGAAGTGACACAAGGCATGTCGCTTCGAGCCCTAGTCGATTGTAGGGCGTCGAACAGCTTTGTACGAC
ACCAATCGCTAGACAAAAGAGTGCTCGAATATGTCGAGCGAGAGATCCCTTCAACGAGGATGACGGTTCGCCTCGCGACAGGCGCATCCGTAACAGTGAT
GAAACGTGTAGTAGGTATTACCTATACACTGAAGGGAGTCCAATACGATGATGACTTCATCATATTAGACTTGGATGACAAATTTTATGTCATCCTTGGA
CCGCCGTGGCTCAGAAGGTACGAGCCACAAGTCAGCTGGCATCGACGAACAGTCGATATGCCTGTCACTTATTCGTCAGATGGTCATCTGATGAACGCCA
TGGAGCGCCCACAAACATGTGGGTGTACTACGAGCGAGTGCGGTGGCCTCGCATGTGGTTCGGTCGTTAGTACGACTGCACATGGTCATGGAGTGGCTGC
TCGCCACACCATGAAGTCAGATTCCGACGACTGCATTGAGATGCAGGTCGCGCCGAAGGCCCACCACCCGAATAAGTCGAGTGGACTGGGGCATGGGTGT
CCTCCAAACGGACAACACCCAAGTGAAAATGAACCGATTGCCAATGATTGGCAATACGACGATCTTAGTGCGATTGGAGAATCGAACGTAGAAGACCTGG
CCGCGTGTAGCGCAACCACCGCCAGAAGATAATAAGGGAGCAATTCCACTCGTGTCAGATGATGAGATATCCCAAGAGGCTAGTGAGCGAATAACCCACC
CAAATGTGGAAATAAGTTCCCAGGAGACAACAGAGATATTGAAATGTCCTAGTCAATGACGGATCAAGCATAGGAACATACCAACTTGATCTGATCGCGC
CTCCGAAGACAACTTCGGAGATCATTCAATTGCCCACGCTTGAACAGAAAAGGTTCTTGCGTGATCTGCGTAGTGGCAAAGTCAAGCAGATTTGCGTACT
CGTCGCGGAAGACGAGTACGTAACCGATATTCGGTCGGCAATGGTATTCGCTGAGAACGAAAGGGTTCTCGGCAGCTCATCAATGGACGAGAGTGTCCTT
GATGAGAAGACTCGGATTGAGCGATATACATCCCAATCGTGGGAATCGCTCAAGACAAATCCTCTCTACGATGATTTGATGGAATTGAGGAATGGGTTCC
CAGAAACAGTTCCGTGCGAGCTACCCAAGGATAAGGGTACTCGTCACGAGATAGACCTGAAACCAGGGTCAAAGTACTGTGTCATGAAGCAATGGCCATT
GCCTCGTGAACAAGTACTAGCGATTGACACATTCTTTGTCGATCGCTTGGCAGCGGGCCATGTGAGGGAATCTACTTCCCCACATAGCTCTCCGAACTTC
TGTGTCCGAAAGGCCACAGGAGGATGGCGGATAGTACATGCCTTCAACAAGTTGAATGCTGCCACTGTACCGGCTCAAACGCCGATACCGAAAGGATGTC
ATTATAGATGGTATGTCAATGAGTACCATCTTTTCATCTATCGATCTGATGGACGGGTTCTATCCGATCCTTATGCGCGAAAAGGACATTCCTTATACAG
TAGTGAGCAGCCCAAGCGGTATGCTTTGGGAGTGGCTAGTAATGCCACAAGGGCTGAGTAATGCCCCTGCTACCGTTCAACAGATGTGTTACGAATCTGT
TGAGATCAGTGCGAGAGTTTGCACCCAGCTATTTCGATGACGTGTTCGTCCATAGCCGGGCTATGGATGGACAGACGGATTTGGAAGTCCACCGACTCCA
CGTCCGAAAGGTTCTTACACTGATTCGTGAGCACAAATTGTATGCCAACCTCAAGAAGCGTATATTTGCTGCAAGCGCAATACCACTTCTTGGATACATC
GTGGGTAAGCACGGCGTCCGGCCCGATCCGGAAAAGATCAAGGCGATCACTGACTGGCCGGTGCCTACCGACATAAAAGGACTTCGAAAGCTCCTTGGCT
TAGCGGCGTATTTGCACAAATACTCGCACAATTACGCCGAGATGACTGTTCATCTCTCTCGTTTGTTGAAAAAGAACGAGAAGTGGGCATGGAGTGCTGA
TTGTCAGCGCTCATTCGAAGGTATCAAGCAAAGCTTGGTACGCTCGCCAGTTTTGGCGATTGCAGACCAAGACAGACCATTTCATGTGGTCTGCGATGCA
AGTGATTTAGCCATCGGATGTGCACTAATGCAGTACGACACAGACGGTGCTGAGCGTGTCGTCTGCTATCAGTCACGTCAGCTGCAATCAGCTGAGCGTA
AATATCCAGTCCATGACAAGGAACTCCTTGCCATGAAGTATGCTTTGGCAAAATATAGAGTCTACCTACTAGGTGATAGACCCTTCATCGTATACACGGA
CCATGCGTCCTTACGCACGGCCGTTAACAGTCCACACCTCTCGCAACGAATAGCGAGGTGTCTGTCGTTCTTCGCGGAGTATAACTTCTCCGTGGATTAT
AAACCAGGACGACTGAATGTCGTTGCCGATGCGCTGTGGCGCCGGCCCGATTTCGAACCGGCTGCGCAATCCGACACTGGTCCGACCACTGTCTCGTTGT
TGACGTCGAGTGTCCCGTCATCAACCTTATTAGAAGGCATACGCAAGGCGTACGATCCGGCGATGATGCGTTTGATGAAATATCTCTCGCAACCATCCCG
TCAATCCCTTAAAAGGTTGCCCCCAGCATATCGATCCTCCACGGATAGATATACAGTCCACAATGGCTTACTGAAGTATACAGCCGTTGCCGGCAACAAG
CCTCGTGTCGTCGTACCGGACCATGGTAACCTGCGACTGCGCATCATGTATGAGTACCACGATGCACCTACTGGTGGACATCGTGGTCGAGAGAAGACAT
ATCTCACAATTAGTCGCGACTTTTACTGGCCTCGCCAGTATCAGTTCGTGCGAAAGTACGTCCGCGCATGCGAAGTATGTCAACGAGTGAAGTCAGGTCC
TTCACTTCGTTCGCCGTTGCAACTCTTGCCCATTCCGGCAGAATGCTGAGAGTCAGTCTCAATGGACTTTGTCTTTAGATTCCCCGCAGACCCACACAAG
AATACAGGTATTCTTGTGTTCGTTGATCGATTCAGCAAAATGGTACATCTGGTCACTGTACCTGAGTCTATCAATGCATCGGCATGTGCTCGTGTTTTTA
TTGACACGATCTTTCGTCTTCATGGGTTGCCTCGTGAACTCGTCTCTGATCGAGACCCACGATTCACTGCGGAGTTTTGGCCATCCGTGTTCAAAACACT
CGGAACGCGCCTTCAGATGTCGACCTCTGACCACCCTGAAACAGATGGTCAGACAGAACGTGCAAACGCGCGTTCTTGAGGAAATCCTTCGGGGTTATGT
CCATTCGTTTACTAATTGGAGCGAATTCTTGTCAATGGTGGAAGTCGCCATCAACAACTCGGTGCGTGCATCGACTACGCATACACCGTTTTCCGTGATG
GCTTGCGCCACCCACGCCTACCCTCCTTCTTAGAGGGTAACTCTAGTTTGAGGGAAGGAGGAAATCATTCGAGCGAACGCCAAGTCGGCTCTCACTCATC
ACGTCCTGACCACGAGGTCACTACGTATGACGCCGATGTCGATCACATCGACTTCGGTGAAGAAGAGGAAAGTAAGAGCGAGGATGCTCTTACTACCCAG
TTCACTGATCTTGCCACAGTGCGCTCCAAGCGTACTACAGCCAAAGACAGCGAGTCAGCAGATGAATTCATACTAGCTCGCGAAACGGTTGTCCGTTTCG
TGCAAGATTCCATTGCGGAAGCAGTAGATCGACAAAAGAAAAACGCAGACAAGAATGGAAGAGCAAATGTTCTTTCATTCAATGAAGGTGACTGAGTCCT
ACTATCTACGGTAAACTTACCTCGACACATAGTGACTAACGAGGGTAGCAACAAGTTACTACCCAAGTTCATCGGTCAATTTCGTGTGCTGCGCCGCATA
GGCAACGCATACACGATTGAACTGCCACGTAAGATGCGCACGCATCCTACATTCTACGTCGGTCGCCTTAGACCTTATCACCAGTACGGTACTTCTTCCG
GTGA