Description :
From Genome Similarity Track
Location :
Scaffold_115:299808- 301859
Sequence
2051 bases(100 bases per row)
GCTCGTAACACATGGATACGGCAGCCTAACGGTCTATCAAAGAACGCCCGTGCTTGACCTTCATTGCCACCAAGTGCTTGCTATTTGCCAGGAAGGCTCA
ACAAAAACTGACTCTATAATCGATAAAGATAATTAGACACGAAGTTCGAAGTCTGTTGGGTGAAGCCATCAGCCCCTTCAAGTGGGAGCAGATGATCCCA
CCAATGACATCTATAGACAATCTCTTTCCCGTGTCCTTTTGTGGTTGTCGACGCTTGGTCTGTTTGCCCTGAGCGCAGCCCAGGCGACTCACACGCACCT
CATATGTCACAATACCCGAAATCATGTCCTTAGCAATGTGTGTGATTGTATCGTAGTTAAGATGGTCAAGCCTGCGGTGGAAGGGCCAGCACGACTCACT
CTGCACGTCCAGTCCAACCGCAGCTTCGTTATCAGTCAACACCGTCATGAACACGTCTCCCACATTCCTGCATAAACATGTTCCCGATATACACACAGTC
AGCGTGTTGTTGGGCTTCTCCTCGTCGAATATCGCCGGACCTTCATTGATTGCTATCACCACTCGATACGTTTCGCGGTACGCGAGGCCGAATCCCTGTG
CCAAATCTCTATGTCTCTAAGAGTCCGTACGAGATGATATTCCTTCCCAGGCTCTCAGCGTATTACACGTTGCGTATCCGTAGTCGGGTAGTACACCCCA
TTGCCGTTGTCACCAGCATCACACTGCCGGGCTTTGCAATCTTAACTGCTCCTCCATCCGCAGTAATGCAGTGGCTATCAAAGATATCAGGATTTCCCAG
TAGGCTCAGGCTGTTGACTAGGTGACGAATTGGCTCACTTACAGGATTTAGTCATTATTTTCAATGGTCGACTAGTCGACCGTGAGCACGAAGTGCACGT
CTCCGTTCCGCTTACTGTTTCCTTTTGTACGGGCACGCCATGCTCAAGTACCCGACCTTCATACACCGGAACAACTTCCGAATATCCTTCCGCCGTCTTG
CATGTCGCTCATGACGTCTCACCCCAGCTACTTGCCACGCAGATCGATCTCCGGAAGTGCTTCAGATCCTACGCTTCGCGCGGATAATCCGTGCGTGCCA
GCGTCGGCCAGGACAGCATCAATAATCGTATGTTTTAATCTGCGTAGTGTACAATGTTGTCTAGAACCAGGTTGTTCGCACCCCCGCACGCCTCACTATC
CACCTCAAGATACAGATAATGTTCCGCGTATCTCCTCTTTGAGCACTTCGGTGCCGTAAACTGCTTCTCGCTCTGCGCAGGTGTAGACTTCGTGGCAAAC
GTGTGCAGCATGCGCTGCATCATATGCTCTAAGTCTGGTTGCTCTTCCCTCCAGCCCTCTACCTACTGATTGTAGTATCGCTCAGCCATACCGCTAAGCT
GGTGACCGACGACATCGACCTTGACATCTTCGCTTCACTGGAAATTGCTTACTCGTTCAGCGAACTCAATTGGGCGCCCAAACCGCTTACCCCAGGACAG
GAACCCACTTCCCTAGTCCACGGTAGAGTGCTTGAACTTCCGCTGCCTAGTACCAGGAACCCCGGTTCTGGTGGTGGCGACGACGGTACCGGAGCTTGAT
ACGACCGTGGGGGAAAATTAAGCTGCCACAATGACGGCAGCGGGGACTGCGCCATCTCGGCATGACTAGCGAGATACCCGACGGTGTGCGTTGCGGCGGC
ATCGGGTCCTGGGCCTGCCTGTCCATGACTTTTTCCCAGACCCAGTGACGACGCAAACCAACTACTCTCGTGACCCTTCATTCGTACCTGCAACGCCTCC
AGGCGCTAGATTCTCTTTGCGAGGTCCGAGAGTAGATCCCGTAGCCTGCCCTGTGTACCCATTCGGCTCGTCCTGCTCCTTAATATGCTCATTTTCGCCG
TACTGGCTGCCAGACCTTTCTCGACTGGGCTGTGCTTCAGGCTTCTCGTGGGCTTCTTCCGCGGCAATAGTATGGTGCATTGGGCCCACAACCGGTTAGG
TGTTGAGGATACACTCTGAAGATATAGAAGTCTTCATTGCAATTAACTATT