Description :
From Genome Similarity Track
Location :
Scaffold_906:2997- 5170
Sequence
2173 bases(100 bases per row)
CTTGAACACACAATTGTCAGTGTTCGTGACAGGTGCAGCTGTCTGCGGAACTAAGTTACCCGCTTGTGGACCTAAGTTACCCACTTGGCCAGCGCCTCCT
CTGGGCGCTGCCACCATCAAAGCAACCTTGGAGTCGTCATATACGTCGATGACATCCAAGCATCTGCCGGATGCTTTGGTACCCTGGCAACCCTTGCGGG
CGCCCCGGGTCCTGACAGAGGTGGGGACATGACTCACCAATGCTCTGTCGGACTGCGCAGGCCGGCTGGCACCGATTGCCTTGTCTCGCCAGTCGATCCA
GAGCTCGTGCTTCTCAAGCCAGGGTATGCCCAGGATCATATCATATGGATCCATGTCGAGAACAGTGAACTGTTCGAGGCTGTCAAAGTCTTCAAACTTG
ACGGCCAGATCCACTTGGACGTTGGGGACAGTGACGACCTTCCCTTTTGGCCAGTCGCACTGACGCCGTCCCGTTGCCCTTGCTTTCTCTCAAAGCATCG
GACAACTTGTTGCTATTACGAGCAACTGTCTGGCGGCGTGCGAAATTCTTCGACGCCCCAGAATCGATCAAAATTCTAAAGGGATGATTTTGCGTATCCC
CGTACACATCCGTGTACTACGAGCAACCCGCCGCTGCTCTTCGCCGATTCGAGAGTGTGAAGACTCTCAGGGGCTAAGTCCCCGTGGTACGCGCCACCCG
CGCACCCATCACGAAGACTTAGTTCTTCCCCAGTAGGGCGCCCCGCCCCTACTGGTTTCCGGCGTTCCCCTGTCCCCGGGGTCCTGGCTTCTGCCAGCAA
CCCTTGAGGACGGGCTTGGGGAAAGACCGTCTGCGGAGTATTTTCGCGGGACAGTCGCGCTTGAAGTGGTCCATCTTCCCGCAGCCGAAGCAGCAGATGT
CACGCTGTTCGGCGGACCCGTGTTCCATGGGAACTGGTCCGTTGGGGCTCGGATGACCGGGAGTCGACAAGGAACTCCCAGGCCACGCTGAGGCCGGCGT
ACGCGTCTGGCGATGGGTGTACTCTTCCTGAAGAGCCACTTGAATCGCCTCCTCAGGGTGTTTGACTGCACCCGGAACAGCTGAGTGCGCACGGGGCCCA
CTCGAAAGCCGTCCATGAACACAGTCATCTTGATGTGTTCGTCGAGTGGGGTTTTCACTAGGGACGCCGTGAGTTCCCGTATCTCTTGCACGTACTCGTG
CAGCTCACGCCTCCCTTCCTTGCACGAGAGGAAGCGCGAACGCTGGCGGTACTTGTAGTTCGCCGGAAGGAACGCGGCTCGGAGCTGTTCACACAGCTGA
GCCCAGGATATGAAACATTCAGGGGATGTTGCTTCCCGAGTGTACACCCAACTCTTAGCACGACCGCTAAAATTGGAAAGTGCAAAAGCAACACGCAGTT
GCTCGGTCGAGATCAGAGCCGCGTCCATCGCGAGCTCTACTTATCGGACCCAGAAGTGAAGCTTCTCGCCTTCCTTCCCTTCATACGGCCTAACCCTTCA
GCATATTGGCTTCGGGTGTGGCGAATTTGCTTCCGCTGCCGGAGCCTGCAGGTTCTCTCGCGCATGCGCGATGCGCCCCTGCTCGTACGCGTCAAAAGCA
TTGACGCGCTCGATCTGCTCGGCCGGTGTTGACACAACCAGGCTCTGCAGGGCCTCCATCCCGAAGATGCCTGCCATCTTCCGAACCGACTCGAACTGAG
AGTCGTTCATATAGGAGAAGTCGTTCCTCTCCATGGCAACGAACTTCGGAGAGGTTCAGGTAGTCTACTCGCGGTGGCGTGGATTGCTTACGAGTGCTAC
CAAGTATGACGGGCCTTGCGCTAGAGGAAGTTAGCTTCCGAGAGTATACAAACTCTCAGTGAGCGGCAGTTCACAGGTCCCCTCTTTATCAAAAGAGAGC
GAAGTGACCTATTTAAGGTAGAACTAGCCGAGCGCCGCCGCGTAGCGGCGGTACTTTAGGTTTAGCTCTACTTGCCTTGGCCTTGCCGCCTCCGCTTCGC
TTCGGCGGGAAAATTATTTAAAAAAATATGAACCCCTATGTACTTCATGAATTTCATAATTCTGGGTTTAATTTAGACCAGTCGCTACAAAATGCTGAGC
TCCCAGTAAGCCGTGCAATTATTTCTACAAAATGCATCACACTTACCATGCTTAAAAATTATTATTCTGGTGA