Description :
From Genome Similarity Track
Location :
Scaffold_1520:2997- 4569
Transcript NameFunction/comments
Phyta_totarag13181hypothetical protein

Sequence
1572 bases(100 bases per row)
AGCGTTTGAAAAGACGTTTTATTGGAAAGACTTATTTGAGGAGAGAAGCTAAGTCGTTTCCGATTTGGATCGATAGGTAATGTACCACATCACTTGAGCG
AAATGCGTCATCGCGTGGAGGTAATTTCGGTGGTTGGCAGACCTGTGGAGGACTACGCAACACCTATTACCCTGAATGATTCTTTACCGCACGACTACGA
CAATGTTGTTCAAAAATTTCTAGACTGTCGCACACCACAAAATCCTGATGGTCCGACGAACTACTagcagcttgagcaccaaGCACAGGAAATGGCGTCT
GACCACATGCAATGCCAGATGTCAGAAGGCGGCAAGGGGCAGCGATGAAGTCAAGGCCGTCTTTGATTATGGAGGCTgtggtcgtggacgaggTCGCGGA
CGTCATTTTGGTGGTCTTGGTGGAGCAAATCAAGGAGGAGGTCGCGGTGGTGAACATGGCTAAGGCAGCAGTTAGCAGCAGTGTGGTGGTGGGCACTTCC
ACTGCCACGagcaagagcttcaagtgcGAGATTATCCATAcctgcccccccccctccctccccaccaccaccactaccGACGGACATCTAAGGTGGAGGA
CCAACGCAGTAACACAGCAAGCTAAGTGGAGGGAAAATGTTCTAAGGCGGCAATAAGGGTCATGGTGCTAATGAAAGTAACAGTAGCGCCTATGCCATTA
TGTGTTTGATAAAATTGGAGAAATCAGATGGCCGACCTTGCTCATGACTGGGCTCTGGAGTCACTAGTCATATAGCGAATCAAAAAGTGGACTTCGTGTT
GCTTACACCGCTAAGTTCGGCAGTGCACACTGGTGGAAATAATTGATTGGGAGATGTGGGAGTTAGAACCGCGAAGGGGCTGACCACAACAATTGGCAGA
TGCACTTTGCTGTTGTCTGGAGTGCGTTATGTTCTTGAGTTACGATGCAGTTTGTTCTCAGTGGGAAGAAATGCTCCACTATTACTGGTTCCTGCAGAAC
GAATACAATGTCAGTTTTGTGAAGAACATTATGCGGACATTGTCGTGCAGTCTAGTAGGACTACACCGCCCACTTGGATGAAACAAATCTCTGCCGTTAT
ATGCTAGCGAGCCCATCGGATACAGTGATAATGGTGGAATTTGATGGAGTGCAAGATGTGGAGTTGTGGCATGATCGTCTTAGTCAACCAGGAAGATAAC
GCGTTTAACGCGGTATATCAACATGCGTAGTGGTCAATGAAGACACTTGATCTGCATGTTCGAGATGGTTTCTAATGTGGTGCATGCGTGAAGGGCAAGA
TGACTCGAAAGCGTTTTTcggtccagcagcaacgcatcAACTCACGAGTAGCTTGTTGGTGAGCTTATTCATGTTGGCGTTTGAGGTCCGTATTCTATTG
AGTCTTACTCAAGCAAGCACTACTTTGTTGTATTCGCCGATGAAGCAAGTCGCTTTGTTATTGTGTTTGTGCTGGCGAAGCGCACAGAAATCTATGAGAA
GTTCAAGATCTACTAATCACAAGTGAAAATAAAGTTGAATGTGCGCGTGAAGGGACGTCGTACGGATAACAC