Description :
From Genome Similarity Track
Location :
Scaffold_146:29963- 33306
Transcript NameFunction/comments
Hyaar_Emoy2811101hypothetical protein

Sequence
3343 bases(100 bases per row)
TTGGTTAAAAGGCAATCCTGTATCTTCTTTACAATCATATCCATGTTCGATGGAGTCTTTCAATATAAATCGTATATACACTCAACGATGTAGTTGCCGA
AGTGCATTTCCAGCAGTTGACATACATAAATGATTACATTGCGGCTTACATTAACAAATGGGAAGTGGCAACATTGGAGTCTCCACAAGCTTTGTTAAAA
ATTCATTTGCTCAGTAAACATGGCGTTATATATGCTCTCAAAATTCGGAACATTGCACTGAAGGCAACGCACACTCACTCCACACGTCACGGTTCTGTTT
TGCAATCATACAGACCATGACAACAAAGATAGTCCATCAATGCATACAAATCTTTAACCCAAGCAAGCTCTCAGGTCACCTGATTGACCCTACGCTACCG
AATGCTTCGATGCTATGAGGCGAACAATGTGTGGTGTCGATAGTAGCGCCGAGTGAATCTGTTTTTTCTCTTGTTGTCAGGCAATACTACGTCAAGCAGT
CAGAGATGATCGTGCTAAACGGCAAGCAGTCAGCGATTGTGGTGGCAAATTAATAGAGACGGATTGGAAAGAAGTTACGGTGCTGACACTGTTGCTTGCA
TTATTTTTCGTGATCGTTAATCGAAACAGCAGCAAAAGTAACGACACGAATTACTCGGATCCGACTTGACCGCACGATTTGCACTTCAGCAGGACCGGCA
AGTTCCTGTGACGTGCAGCTGCTATCGACGATAACTTAGCAGTAATACAGACCGCCAAAAGGAATGCCGAGGCCGCATCCACCACCGATGAGACCCGAAC
TAGTGTTCGCCAGCACGCGTACATTGTCCACCGCCGCAGTCTTCTCACATGTATTGAAATAACCATGTCGTCTTTTAGTTGCTTCGAAACCATCGTTGGC
TTGCCAGGAACGTCCTACCAGTTACTAATTACTTTTTAGGAATTATATTTTTTTAATTTATAATATAAATTATTTTATTAAAATAATTGTTTAAAATTAT
TAAAAAACTAAAAATTATTTTAAAAACAATTAACTTCCCTGATGTGACGGGCGGTGTGTACAAAGTCCAGTAACATATTCACCGCAACATGCTGTTTTGC
GATTACTAGCGATTCCAGCTCCTTGAAACTATGCTACCTAATCGAATAGTCCTCATGGGGGTTCTTCTGGCTTCATTAAATAATTCAGTTTCTAAAAAAA
TTTGTCCATCAGTAATAGAAATTACATTAGTTGGAATATACGCTGATACATCACCTGCTTGAGTTTCTATAATAGGTAAAGCAGTTAAAGAACCACCACC
AATTCTTCTATTCATTTTAGCCGCTCTTTCTAATAAACGTGAATGTAAATAAAAAACATCACCAGGATAAGCTTCGCGACCTGGAGGTCTTCTTAAATAA
ATATCTAATTGATTTTTTGAATTTATTTTAAATATTTTTATTAAAGAAGGTCAATTGGATCCAAAATCCAATTGCGTTCGTTAGTACAGATCAAAGGGGC
ACCTAACACACAAAAACCTGACCTGCTGCTCTCCCAGCTCACGGACTATTACGGGTGTACACCACTTAAAACATTCATAGTCTTGTTTCTGCCTGTTATT
GATAGTCACACGGACATATCACGCATTCGTTAGGGCAGCAAAATCTTCACCGAAAACAGCAAATACGGACCTGCTGCTTCCTTTCTTACAACGAACGATA
CTGTGTCCAAAGAGGCCCCCAAGATCAGGGGATAGTCAACTTCGTGCATCGGGATCGCACAATGTATGATTACTGAGATTGAGCAGATCGCAAATTGATA
AGTGGACGAACAGTTGGACAAAATCGTAGAGGAGCTACCCTTACTCCTTTATCAGAGGAAGTCTTATATACTAGTACAGTCTCTTAGCGCATAAAGCTAA
ACGGGTATAGACTTAAAGGGTCTCAAGTCTTTACAAACTTAATAAGACTTAACTCTAGGTATCCAAACAAGATCGCATACTTCTATTCCCGGTTCAGGGG
ACTTACAGCTCCAGGGAATCGTGGCAATAATGCCAAAGAGTACTGGCCTTAATACAGTCTCTAAACTCTCACGACCAGAGACGTCTTCGAAAGACACGTG
TCTTAAACTGATCAAAAGGGGAACTGAATTTATTTTCTAATTTATAGTAATTATAAATATCAACTACGTATATAACCTTCAGTCTATATTACCTTATCTG
ATATTCTAATTTAGATTCTTCTAGTTTTACCACACGACAACAACAACTTCCTCAGAATACCGATTTCGATATATACTATCTAATCGTAATCGATAAGGTA
CCGTATTACCGCTTATCGTATTGAGTATAATAAAACGCTTGTCAATTTCACTGATCACTTTCTGGGTGGATCACACGGTTCCATACCGTAAATACCAACC
GTTTGTGTGACCCCGTTACACCCTCCTCCACCAAACTTTCGATACCCCGAATCGACATCATTCACTTTTATCATCGAGATCGCTTGGAGATAACAGCTAA
AACTACAGTTATGTTCGCGACACCTTGCACATCCATAGCAAAGACTTCCAATTCATCTGAGTCTTTGGAAGACACCCTGGTAGAGAAGACCATAGTTGAC
TACGACAACGACACGTTCGCGCCAGGGGTTGAAGACCCCAACCCAAACCCTACAGTGTTGCAAGAATCATCGCGCACAGCGCCCAATCCTTTTCCTGACC
GAAGCACCGCTCATACGCGAACAGCGCTTCTTACATCGAGTACCCTTGAGTAGGAAGGATTCATCACGAATAGGCTCGATGAGCAATAACTGCACTATAT
CGATACGAACTAGAGAGCTAGAAGTCTGTCTCATATGTTAGCAGTGACCGAGGCTCACACCGATTACATCTTCAAGCCATTGAGCGTGGATGAGCTCCTA
AGGAAGTTTTCGGGGCAACCAATTAACCACTTGGATCACAGGACCCGAGGCTACGTTTTCTGTCGACATTGCCGAACGAGATACTCTCAGAAAGAGATAC
CTAACGACCGAAGTGACGAAGATCCAAGAATACCAGGCCAGGTTGGAGGAACAATCACGCGGTGCATCTGTACCCACGTAGAAGACAATTCCGATTGTTT
TGCACTGACGAAGAATGTGGCAGAAGACGACACCACCTTAACTCGTTGGGCTATTTGAGCACGTCGCTTGCCCAGCATGGTCACCTATCGATCTAGTGCC
TCAAAAGTCGACGTTCGCTTCAAGCGCAAACTGCGATATGAGCTCACGACAGGTTAAAGACTAGCTGCGATCATTGTATTGCACCCGATACGCAAAACCA
AATGTTGGTCAATTCTACAATGTTTCGACTGCACATTCAGTCG