Description :
From Genome Similarity Track
Location :
Scaffold_652:2996- 5740
Sequence
2744 bases(100 bases per row)
GTATGGCTTAAGCAAGCCAACATAGAAGACCGGATGCGTGCGCATCTTCTTCGGAAGGTTGAGCGTATACGTTAGGCCCTTCCTGGCCACGACCATGAAC
GGTCCTATGAACCAAGGTCTTGAAGACTGCAGACACTGCATGAGTAGGTAGGTTTTTAGCGTTTAATAAAACTTGGTCACCGACCTCAAACCTCTCAACA
TTGCTTCTGCCCTTGGCATCTGCATGTTCCTTCTGCGTGTCTTGGCTTTCAGCCATAGCGTCGCGTACTTGACGCATTACGCTCAGTCTCAAAGAAACAA
AGTCATCGACTTGCTTGCGAACCGCAACACGGCTGACATCAGCTAGCCGCTCGGCTATCCCTCCCCCATCAAGCCCTAAGCCACGGGCGTGGCGGCGTCA
GTGGGACGCGAGGGTTATCCAAGCCGTTCACATAGAACGGAGTGTAGCCTGTCGAGGCGTGCACTGCATTATTTAATGCGAACTCAACGAGTGGGAGCAT
CTGGCTCCAGCGTTTTCGCGCCTCAGCGCATACGCTTCGGAGGATATCCTCCACAACGCGATTCACGCGTTCGGTTTGACCATCGGTCTGCGGATGGTCC
GCTGTGGACATGTCCAAACGAGTGCCAAGCACTCTGAAGAGGGACGTCCAGAACTTCGCGGTGTAGCGCGGGTCTCGATCCGAGACAATTGCCTCAGGCA
AGCCATGTTGGCGAAAGACTCGGTCTAAAAACCAGCAAAGCTGTACCTTCACCATCTATGGTGTCCGGCACCGCCGCTAGATGAGTCATCTTGCTCAATC
GGTCTACAAAGACTACAATACCCGTGTTTCCTACCTTGTCCTTGGGAAGGCCAAACACAAAGTCCATACTCATGGACTGCCAACATCCCTTGGGGACAGG
CAAACTCGCCAATGGCGCTGCCGTGCTCGGCGCGGACTTCGTCCGTTGACACGTCTCACACGTGCGTACATAGGTGCCAGCCCACTTATACATCTTGGGC
CACCAGTACATCGAGCTCACCGAGCCATAGGTCTTCTCCCGACCTAAGTGCCCGCCCACGGGCGTATCATGAACCTCATAGAGGATTCGATACTCTAGAT
CCTCATAATGAGGAACGATTACACGAGGGTTATCCTCAGAGTCGGTGCTGTAGTACAGCAGGCCGCCATCGAGCGAGTATCGATGCAGCCTCGCGCGTAA
GCGCCCAGACAATTCCTTGTCAGAGTCTTTAAACTCTTCGCTCTCAAGAGCCCGTAGCAGCGCTACGCACATGTCGTCTTGTGCATACGCTCCGCGTATC
AAGTCAGGCACTGACGACGTCACTGTCGTGACATGAGCTAACTCGTAGTCCGGCCTGCGCGAGAGCGCATCGGCCACTACATTAAGCCGCCCCGGCTTGT
ACTTCACCTCGAAGTTATACTCGGCAAAGAAGGAAAGCCATCTTGCCATTTTCTGAGAGAGATGAGGCGACTGTGTCGCAGTGCGTAACGACGCATGATC
AGTAAAGATCACGAAAGGCTTAGAGCCTAGCAGGTGTACCCTGAATTTGACTAGAGCATACTTCATTGCAAGTAGCTCTTTGTCATGAACTGGATAGTTC
TTCTCTGCAGCTTTGAGCTGGCGAGACTCAAACGCGATCACGCGTTCACGCCCTTCGGCGTCTGCTTGTAGTAAAGCACAACCGATTGCAAAATCGGAGG
CGTGACAGACGACGCTAAACGGACTATCCGGGTCCGGTAGCGCAAGGATCGGAGCCTGGAGAAGGCTCTCCTTCACAGCCTCAAAGGCTCCGTCGTGCTC
GACGTTCCAGCACCATGGCGCGTCCTTCTTAAGGAGATCTGATAATGGCCGAGCCATCTCCGCGTAGTTTGCGCTGTATTTGTGCAAGTAATTGGCTAAG
CCTAGCCACTTGCGTAAGTCCTTTTGGTTCTTGGGAACAGGCCAGTCCACGATGGCCTTGACTTTGGCAGGATCTGCCCTTAAGCCTCACTTCCCAATGA
AGCACCCGAGGAAAGGTATTTCCTCCGCGCCAAAGACGCACTTGTCCAAGTTGGCATACAACTTATTAGTGCGCATGCACTCGAGCACCGCTCGCAAGTG
GTCAATGTGGTTTTCCACGTCTGACTTTCCGTGCTCAGCACGACTATGGACGAATATATCGTCAAAGTACGTTTGATCGTACGCCCGGTGGGGCCTAAGC
AACTGCGTCACAAGACGATTGAACGTTGCTGGTGCGTTCGACAGCCCCTGGGGCATCACCAGCCACTCGCAGAGCATACCGCTCGGAGTACTCACCGGTG
TCAGCGGAATGTCGCTCGCTCTCATGAGCAATTGGTAGTAGCCATCGACCAAGTCGAGCGCGCTGTACAACGTACAGCCTACCATGTTGTTCTGCAGAAC
ATCCTTGCCAGGAATCGGCGTTTGCGCCGGGATAGTGGCCGCATTTAGCTTGTTAAAAGCATGAACAACGCGCCACTTGCCGTTCGGCTTTCTGACACAG
AACGTGGGTGTCGAGTGCGGAGACTTACTCTCACGCACCATCCCTGCCTCGTGCTTCGCACGGAAGAATGCGTCAATGACGTCACACTGCTCTCTCGGCA
AAGGCCATTGCCTTGTTACGCAGTATTTGGTTCCAGGAACCAGGTCAATCTCATGACACACGCCTCGATCCAGAGGCAGGCCCGTCGGTGGGTCTTTCGA
GACAACGTCTCCATACTCCTTCACCACCGGGTAGAAGGGATCCG