Description :
From Genome Similarity Track
Location :
scaffold_141:29959- 31230
Transcript NameFunction/comments
g1335.t1hypothetical protein

Sequence
1271 bases(100 bases per row)
GTATACCGACCAACGCTACCAACCAGCGACGACAACTCACAAGAAGGAGTGTCTAATTCCAATGATACGGTGAGCAGCAAGACCCCTGCACCCGTGGATA
GTAGTTTTGTGTACCGACCAACTCTGCCGGTCAGCGACAACGTCTCTCACGACAGTAAACCAACTCATATTGACGCAGCGGATACGGATGTCTCCAGCTT
TGCATACCGGCTTACCCAGCCGGACAGCGATGATGGCGGCAAAAACTCGGCTCGTGACGAAGGCGTTAGCCAAGGGACTGTTGCTACACAGGAGCGAGGA
AACACAAGGATGAACGTTAAGGTCGATGCAGCGCACGATAGCGGTGAGAATGACCATGGACACGAGCCATCATTCTTGAGGGGAAAAGCTTCTTTTCATG
TCGCCACCGGCTACTTTCTATTACCGGTGGCTTTTTTCCATGAGTGCAGTTACATTGTATTTCGATGGCTATTATTGATTTCGTAGCTGTACGAAATTGA
TGTAGCGTTCAAATGAGGGTGCACAGAGACGAAAGGGCAAGAAGTGCACGTTTGGGAAACTGATTGGAATTTTACATAGAAATTACTTGATAATATCATA
CTTTATCTGACGATATGTTCTCTATGAAATGTCTGCTCGGCGGAGCGGAGGCGATGTTCACTTCGCATTTGCCATGCGCGCTCTCAGGCACATTCGCTCC
GCCGTCAACGATGCCTACGACGGCATCCGGCGCCTTCGACAACAACTTCGCGATGCTGAAGAGACGATCCGACGCCAAGCGCGCGAGATCGATATGCTAA
CGACCTCGCTGCGCCGGATCAGACAGGGCCGCGAGCTGGTCTCTGAATCCGCTTCGGACACGGAGGACGAAGAGATGTGGGGCTTTCCATCGCCGCGCCG
ACCAAGGACACCGGAATTCGTCGACAACTTCAACTCCACCACACCAAGCCCAAATCTTGCAGGCTATTATAGCCAATCAAGCGACGACGAATCTGAGGAT
AGCGATTGATTCTGATTGGGTTGTAGCCAGAAAATTTCATTCATTGCAAATTTCATTTTGTTCGTTTCAGTACATTATAGGGTAGTAACGTTTAAGTCAA
ATTTCTTTCTGGAGTTAAAAAATTATCTGTGCTGCTTACAATGCGGTTCCTACTAAATCCAGATAATATACCACAAAGAATTTTCTGAAGCTCAATAACT
GAAAACAAATGACATTCGTGCGCTATCCTTCCAATATAGAGCGCCTTTGCAGCTGACGTCTCCGTCGGCTG