Description :
From Genome Similarity Track
Location :
Scaffold_79:299578- 302708
Transcript NameFunction/comments
Physo_139889hypothetical protein
Physo_139890hypothetical protein

Sequence
3130 bases(100 bases per row)
AACCACCTACCAGACGAACAAGACGTCGATCAGAGCGGAAGCTCTGCACGTTGTTCTCGCTCTTGGTTTGCTCAGCTTCAGCCTCGCTCTTCTCGTTGGG
GTTACGGACTACATTTACGTTGGTCATACGCCAGCAAACAACCGCATTAGTACACTCGTTGAAACCTTACTTGTGCACAGCCACTAACGTACATGTCCGA
ACAGGAAGCAGCTTCGGTCCGCCGAGGATCTTCAACATTTCGAAAAAGTTGATGTCGCCAGCTTCCATCGCGATGTACTGCGAGTCGAGCACAAAGCTCT
CCCGTTGGTGCTGCAGCCAGCAAACACTCCATCAGAACAGCCTCCTTCAACCACATCGATTCATTCTACTGTTCACGCACCACCAGGTTTTTCTCGAAGA
AGAGCTCAGCAGCAACTCGACCGTCTGTGTACCCGGTGTCCTGGAAGTGGCGGATTTGCTCCAGGATGGCGCAGAGCAGCTACCCCCCCCCACATCCACA
AGCGCGTCAGTCCATGCAAGTTCAAACGAGTATCCGACCAGAAGGCGTACGATTTCGTAGGACCCCTTGACTTTCGTGTGGACGCGGAAGTAGCTGAGCA
CCTCTTCGTCCGGTAGCTGGAAGATCCTGTCAACACCAACGCTATCGTCAGAACAGCCTCTTCAATTTCAACGTCGAGGCCTATTTCTCTCACCTCGCTT
TCGAGTTCTCTCCAAATCGCGACCACCAAGCTATGAACCCCTTCATGTGCTCGTCCACGAAGTGTTTGTACTTGTTCATGTCGGCCTTCATCGCCATCCG
CAGCCGAGCGCGCTCGGTCAGGATCTCTTCGTGGATGAACATGGGCCACGGAGAGAACTGCTCCTTCTTCTCGTCATCCGTCTCTGGGAAGAATGATCAG
CACGGTTAGCTTACTTCATTCTATGAGCCCCTCCACGTTGCCAACCTACCCCAGTCCGAGCACTTGCTGGCGAAGTCCGCCATGTTCATGATGGTGTGCG
TCACGCCGCAGCAGCTACAGCCACCCTGCAATAGCAACACCATCATTGCCGTCGATTGAGAGTCCTTGCATCACGAATACTATATATTAGAGTGTCCGTA
CCTGGTTGACGTACTCGAACATGGTTCGGTCCACGACCCACGTGTCCTCGTACTTCCTCATATTTTACTAACTCTTCCCGTTGTCTTGCTTCTCCCGCGG
CAGAATGGCGAATGAAATGAGATCGTGGGTCATGGGAAGGCTGCCCTCACTAAAAGAAGAACCTCCACACTCCATCTAAAGTTCCACTCGAACTACCGTA
TAACCGTCACACTTCAACCAGGCCCAAGTAGTCACTAAAACGAGGCTCTTATTCCCCCTCCACACTGACAGCACGTCAATTTCGACGTGAGGCGCACAAA
GCAAAGAGCTGCGATAACAAGTGCGCGTCCATCATGGCGTCGCCGCCCGCCCCAGAGCTCGCTGCAGCCCACGAACCGCCGCGTAAACCGGCCGATACTA
CTGCGCATGTCCACGCACAACCGCCGCCAAGTTCTCAGAGCGACACCATTGATAATGACGGAGATCTGCGCCGTCAAGTGGGTCGACTCGTGGTTGACAC
GCAGCAGACCATCGACTCGAACCTGACACTTTTCCGCGTGGGGCTCCTCGTGACGGTGGCCGCGTCTATCGCCGCCTCCGTGAAGCTCAGCGGTGTGCTG
CACAAGGTTCGAAGTGTGGACGACCTTCCATTGTGGCACTTTGCGCGGCGCAAGAAGCTGCGCGTGCGAATGATTCGCCAGTCGCGCCAGGACCCCAGCG
TCTTCTACGTGTACCACACGCCGTTCGTGCGCCGCACAGTGCTGCGAGACGAGTTGCCGCCGATCTTGACGGTCGGTGGTGATGTCGAGAAGAAGGAGAA
GGAGCTTCTGGCAATCAGACCGTTCGGAGTGCAGGTGGATGAGAGCTCCGAGGAGTGGGTCTGGTCCAACTTTGTGTCTTCGCACCGGTACATGACAATT
CAACTGCTGCAGAGGTGAGTTTGGGCTAGTCGGAAACAACTTCGAGTGTTGTGTATAGTGATGTGACGGGGTGCGGTGCTGATTCGACAGGATCAATGTG
GAAGGGGGCGAGAGTGTGGCAACGTGTAACATTGCGATGGGGAGGGTGCGTAGTGGCTTTCCATTGTGGTGGCGAGGAAGTTTGGCTCACTTTAACGCTT
GTTATTTGATCGTTGTAGCCACCTTTTGGTGGTGACTTTGCTCAAGAGTTGGTGTCACATGGTTACGCCGAGTGCATTCCGGAGAACCTTGAGAACTATG
ACAACGGATCGTACGTGGCATGTCGTTTGAATTGCTAGTACATGAGAGTTGGAGGCTAATTGCGGCGTGGTGTGTGCTTTTCTGTAGAGAAACTGGTATC
TCGACGCTCGCGCAACGTCTCAAAAAGCTGGAAGCCGCTCAGAACCACGCACAAGTAATGCAGTACGGAATCTGGAAAGACTGGCAAGAAGAAAAGCTGT
CCGATCGCGTACTATCGGCAGGCAGGCGCGCCACCTCAAAAGGATTCAAGAAACTAGTCGACAGTATCCGGCATTGAAAAAATATTTGGTGGACGTCACG
AATGCTTTTTCCTTTCGATACCGAAAGGGGTTTTGTGTTGAGGATATTGCTGTCACAGCACTAAATCTGCTCACTTTTAATTCTCATTTCCCATTAAGCG
ACTGTGACCACGGGCTCTTGCATTCTTTCTCCTCATGGTCCGCACGGTAAGTGATTGCAACGAATTTAGTGGATTCATCACTTCGAACAAGTCGGCAATC
GGGTAGGATACAATGCCAATGTCAACCATGTAAACTTTGATAAAGTAGACAACCCAATGACGTCGAAGGCCACCCATTCACAGCAGTGGTTTTTATACGA
AGCGTAACATTGTCCACTAGGAGGGCGTCAGAGACAACATTAGTAGCACACGTTTTCAAGTGATGAAGAACAGTGTAGTTGAACCCCGATCGATCCAAAG
ATTTTCTGCCCCCCCCAGATAGGCAGATCTGTGCTTGCTCGTGGGTCCTCAGAGAGGCCCTGTAAATTGTAAGTTCATTGCATGTAGCGACCCGAAGGGC
TCGCAGTACAGTATCATAAACAATAGGCCG