Description :
From Genome Similarity Track
Location :
Scaffold_98:299490- 303193
Transcript NameFunction/comments
Physo_141454hypothetical protein

Sequence
3703 bases(100 bases per row)
CTCCAATGTCGAAAACATGCTGGGATTGTCTTTGTGGTAGATATTCACGTACGAAAACCACTGGTCAAGGAGAAGATTGTCGTTATAGACAAGCCGGCGG
TGGAGCTGTGGCAACTTGAACACGTCGTCGGTCGGCTGATTCTCCACTGCTTCGCCACATTTCCAGTTGCACAAACTCCAGTATTATGGCAACGCCTCGT
GTGACCTTGTTCGCCTTTGCGACAATTACCATCTCCACCACCTGTGTATCGCCATACGCCCGCGTAAACATTTCAATTATTGTCGTCTTTTGCTGCGGAT
ACTTGGCGTTATAAGCTTCCATGTACCTGACCAAAATACTAAACAGTGGGTTCTCCAGCACAGTGTCCACTTTACTCCCGAGTGAGTGCTGTTCCAGAAC
ATCATCTGGCTCCTGTCTCGTGATTCCGCTGCCTTGCGGAGCCCCAGCTCGATCAGAGCGTTATCCGGTGTCTTCCGAGCGCTGAACCAGTCCAGCCTCT
AACTTGACGGCATTGCTCTTGGTTTCATCCGCGCCCTTCGCGGCTTCGGCCATGTTGAATAGAACACTGCTCCTGAAGTACTTCATCAGAGACGGAGCTA
CTGACGTTGTTTTATCTGGATGCTTTGCATAGAAATCGTCGACGTACTTGGCCCAAGCGAGGAATTCGGGATTACTAAGGATGTTCGTCTTCAACTTGTC
AAGGTTCATCACGTGAAAAACGTCGTCAGGAACGCTTGCTCGGTCTGTAGCCACGTCGCGACCTCTATCGTATCTGAGTATCGCGTGGCGGATTTTATCA
TGCCATACGGGGCATCGTCTCCGTAGTAACCAGTCAGTCTCGAGATTGCGGGCATTGCCTCCTTGGGGTGTTTGGCATTTAAATCGTCAACGTACTTGAG
CCACTGCTGGAACAGGGCAGTGCCCCTCCGACATCAGGAAGATACATGCGATAGAAGACCTTATCAGCAGATTTCCCCTTTTTGAGCCATTTGTTCAGCT
TTTCCGGGGCAACGACCGGACCCGAATCTTGCGTATCGTCTTTTCGAGGAAAGAAGGTTTGGGCATCCCCGCTCTCTCTTCATCTTCTCGTTCGTCGATG
CCGATGCTTCGCAAAAATATCTCAGTAGTGTGGAAGTCATCCCAGCTTGATAAGACGGAAGGGCCCCTCACCGACGCTTCTGCGTGAATACGCGCGATGA
AGGCGAGGAGAGCCAAGGCCACCAGGGGCTGGAGGTACATCGTGCTACTTGTTGGTTGAGAGGCAAGTTGGAAAATGTAATTCCTTGTTGTTGCCAAGTC
TTGGAAAGTCTCATGATTAGATGAGTGCACGTTACAATATCGTGTACTTGTACATGTACACATGTTTACGCGTTCAGTTCAGAAAAATACGACATCGGGG
CGCGCCCAAAAGAGAAGGAGGCAAGTAATAAATGACGCCAAGGTAAGGAGCTCTCAAGGGCCCTCAGTACAATAATCTTTAGGTAAAAAAAACAGGAGTA
TTTAAATATTCTTAAAACACCATCATTGAATACTATAAGAACTGTCGTTTGCGCCCTGCGGATGTTTGAGATAATGCAACATAAGGTTTTTATGTTGCAT
TATCGGTTAAAGAGCTATTTGAAACAACAGCAATGACAGTTGTACAGCAGTTATATTACAGCATAGCAGCGCAAACGAGATCGAGCAGCGTAATCGACCC
AGCAAATGGGCGCATGATACTTCACAGTACAAAAATAAGAGCATGTGCTAAAATTCAAGAACTTCTTCATGCAGCGCTCTTCTACGGCAAGCGTAGCGCT
ACTACATAGTACTATCAGTAGTAAATAAAGTTTTTCTACCGTGCAGGTTTTGGAATCCAGTAAAAAAAAAAGCGACCGAACTGCGAACATCGCGGGCCAA
AGCCCGCAAACCAGTTAATGGTGGTGTTTTTATTTAGTTTGTTGATAATATTTCCACTTGTTTGTCGCCGTAAGAAAACGTTGTGAGACTTTTCGGGCGA
CTGATGCTTGCATACAGAGTGCGCGCATGTACAATATAGCATGTAAATGTGTAAAGTTCAGCAGCGTTGGACTCGCGGCTTTCTCTACTGTAGTTAGTTG
GGGACACCTGTAAGTTAATTGCAGCCCATATTTTGTGTCGCCTCAAGTTTCTGAACTTTTTCGAGCTACATCCTCTAGCAAGTACTTTCGAAATACCAGT
GAAAAGTACTTTCAAAACAACAGGAAGCACGGGTGAAACACAAATCAAAACAAAAAAACCACACAACAAACCAACCAACAAGGCAAGTGACGAATCGGGC
TTTTTCCGTTGATATTCAGGCTTAGCCGGAGGAGAAAATCCAAACCGCCGACCGATTTCGCTTGAATGACTTGCAAAGCAGGCCGCCAACGAGATCGACG
GCGCCTAATACTGTGGGGGCCGCGCTAACGGCCTTCAGCGGGTAGGGTGGACGTACGGCCATTGGGGAGACAAGCATGGTAAGTTACCATCCCCAGCCTC
CGCCGCAACCCACACCGCCGCCCCAGCCCCAACCGCCTCCCCAGCCAGCGCCGCCACATCCCCACGGACGGCCCCAGCCACCTCCCCAGCCCCACGGACT
TCCTCCCCAGCCCCACTCCTTCTTGTCCTTCGGCTCGCCTGCCGTCGGCTGCGCGTCCGTGGCCTCCGCCGGTCCGGTTGCGGTGGCGACGACAGTCCCG
ACCTTGGGAGCGTCAGCCAGAGCTCGAAGCGCGGGCGATTCGGCAGCAACGACGCCCGCGGTGGCGAGCACTGCTGCGACGGCAATGGTGGTGCACTTCA
TGTTGCTGCTTGGGTACTTGCTAGCTTGGTGTCGAGGAGGCAAGTTGCGGTATGGTGAATGACACCACGGGTGCGGCCGAACGTCGGTCCAAGGGGTCAG
CACACGTTGGCTCCGCGCGGAGATTTCCGTCGAAATCGGCCCCTTTCCGCATCAATCAGGAGATTTTTCGTCTTGCAGGCGATTCAGAGGATCGCATGCT
TCGATTAAAGTTAGTCGATGAGAGTGCTACGAATTCGAGGGAGTATTCGATCGGCTGGGCACTCTGTAGCGGTGTTTTTATTGATTTTGCTTACCGTTTT
GTCCGTTTGTTTGTCTAGAGAATAAACTGCTGTGAGAATTTTCGGGTGACTCATTGCTTGCACACACAAACAATGTGAATGCATAAAGTACATGTGCAGC
ATGCGCGTGTATGAAGTATGGCATTCGCCTAGCGCGGAGTGGTTCCAACCAAAATAGTGAAACCCAACATTCAGGCGCTATGTTGCGTCGCCTTCATTTT
CTGGACTATTTTCAGGGCGCATGTAATAGTTTACTTTCAAAATAGGAGTGAAAAATACTTTCAAAACAACAGGAAGCACGGGTGAAAACATCCAAAGTCG
ACAAACCAACAAAGGCAAGTGGCGAATCCGGAGTTTGCTTTTGATTAAAAGAATCCACGCTTAGCCTGAGAAACCGCCGACCGATTTCGATTCAACGCGC
TTGAATGACTTGCAAAGCAGGCCGCCACGCTAGGCGAATGCCATACTTCATACACGCGCATGCTGCACATGTACTGTACGCATTCACATTGTTTGTGTGT
GCAAGCAATGAGTCACCCGAAAATTCTCACAGCAGTTTATTCTCTAGACAAACAAACGGACAAAACGGTAAGCAAAATCAATAAAAACACCGCTACAGAG
TGC