Description :
From Genome Similarity Track
Location :
Scaffold_317:29946- 33554
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_317-fgenesh-gene-0.3DnaJ (Hsp40) homolog, subfamily C, member 11

Sequence
3608 bases(100 bases per row)
GcAATCATGgcGCcTATGGtCCcAGATGACGCCGAGTTCtGGCGGCAGCTTGAGCGAGACTACTACGCGCTGCTGGGCGTGGCCCGCGATGCGTCGCAGG
AGGAGATCCGCGCGCGCTTCCTGGCGCTGTCTCGCGAGTtCCATCCCGATCGCCTGCGCAAGCGACGAGATCCGGCACTCATCGCCGTGGCCAATACGCA
GTACCCCGTGCTCGACCGCGCGTACAAGGTGCTGAGCGACCCAATGAAGCGCCACGTGTACGACATCTACGGAGAGCGTGGCGTGACGGCGCTGGATCAG
AGCGACGCGCTGCAGCTCGTCGTtGgCGCGCATCTACAGTCAAGCGACGAAGCCCAGCGGCAAGTGGAGAAGGTGCTGCGCCGCCTCAACCAGCAGGCGC
TCGAGGCGCAGTTCTCGTCTTTCAGCGAGATGAGCATGGGCATCGACGCGTCCGACTTGGTGCATTCCCCCATGCGCGGCCTGCGCTCACTGCTTCGGGG
CGACCGCCGCCTCGTCGAGCGCACCGAcATGACCATCCACCAGCGCACgaCCTTCCCTCTCTCGCGCAATACCAAGCTCACaCTTGGCGGCTACATGTAC
GACAAGCAGGGCCTCGGCATGGGCTGCTTCACTACGCGCCTCGAATACGCGTCGCCTGACCCGAGCCTCCCGTCGTGTGCGCTCTACTCGGAACTCGGGT
GGACGCCCAAGCTCCACTGCCAGCTCTCGCAGCCCATCTCACCGTACACCGTCGTCATGTGGATCCCAGAGGTCGACGCGCATGGCCTCGACATGTCATT
TGGCGTCAACCAGCTCCTCCTGCCGCAGCTCAATGGTGCCATGATGTGGTCAACGCGCGACGGTCTCTCGGCCTCGCTCAGCAATGACTCGCAGCTCGCC
CACAACTCTGTCGGCGTGGCCGTGAACCAAGGCGGCCCATCGCTCTCGCTGCAGTTCCGTCGCTCGCTTCTCAAGGCGACGATGACGGCCAAGGCATCGA
TCCGTGCCAGTCTCGCCACGGGCGTCTCGCTCGTTGTCGGCGGTACCAAGCAGATCTCCAACCGGACGCGTCTGGCCATGGGTGTGCTCTTGGCcCGCGC
GGGTGTCACGCTGCGGCTCGGCTTTACGCGGGGCTCTGTCCGCTTCGTCATGCCCATCTTCCTGTCTCCGTTCTCGGCCCAGTCGGCGTTCTCGACTTTC
CTCGCTGCCACGACCCCGTTCGTCATCTCTGCCGTCGTGACGCAGCTCGTCGCGCCAGCTCAAGAGCGTAAGCGTCGTCGGGCACTAGAGCACAAGCaCG
AAATGCGTGTTCACTACGTCAGCTCAGCGAGACGCAGcGCCCTGGCGCAGCAGCAGCTCATGTCAGCGTGTGCCGCGGAGAAGACGGAGGCGGAACACAA
GAGACGCTATGGTAAGGGACTGATTGTGCTCCTAGCGCGATACGGTCGGGACCCAACGAACCCAGACCCGATCGACCGGACGGTGGAGCATGCGCGTCGC
ACTCGAGTCACAGATGAGGACACGTCTGGCAGTCGCGATGGCGCGCACACGGGCTCCGACGCCACAGGAAGCACCGCTAACTCTGGCGTGAACAGCATGG
TAGAGGATGCCGACAGCGACGAAGAACAGGAGGCGTTGACCCACAAGTGGGTCGACGTCACGGTCCCCATGCAGTtCTTtGTTCAGGACTCGGTCGTGAC
ACTCCCCGGAGGAGCATCGAAGGCGAGTCTCCTCGGCTTCTACAACCCAAGCGCTGGCATGGACGAGACCGAGGTGGAGACGCCCCAACTGTACGTAGAC
AACCAGCGTTTCGAAGGATGTGGACTGAGTGCTAACCATAAACTACAGGTATGTGCGCTACGCGTACGACGGCACCGTGTTCGAAGCCACgTTCgACGAT
CACCAGGCCGTGAGTTTGCCATCGCGATACGCACAGGTGATGGGgAAGACCGGCGGCGTGTACTAGGACAGGCAACACAGTGGAATACACGCAGTTTtGT
tAAGCTAAAGAAGCAGCAATGTATGCAAAGGCGCCACGTCATGTAGGAAGCTGTCAaCGAAAGCAAaGAGCGGGGAGAGTGGTGGTGGGTTCTCTTCGCC
GTTGAGTTGGTCATGACGAAGCCGCTGCTTGGtGAAGaGGATGACCGCCAGAGCATCGAGGAAATCAGTGAAGAGCAGATCGGTGTCGACGAAGAAGACG
TCTGCGTCGtcGACTTCAAaGGCGAAAaCGTGGTGCAGCGCGCTCAATGCAACCTGCACGCGGAAGTCTGGGGTGCCGACcACACGTAACTTGTGGAGGA
GCGAGAGCAGTCCTCGCACACTCACATAGGCATTGGAGCTTGTCCTGCCATCCTCTTGGTCCTCGGGCTGTGTAGGTTGGCGTGGCTGAGACGCAATGAA
TAGACGCTGCAACGCCACGTGGTGCTTGATGAACACCGCGTGCAACTCTTTGCTGTAGAGCTCCTGCTGCAGCGGTGAGGAGGaCTGTCTCTGCTGCTTC
TCACGCATCATCCGTTCGTGGAAGGTCGTGAAGCCGTCTGCTAGCATCTGTGTCGACTCTCCGGCGGCTGCTTCCCTCGTGGTCTCGTACGCCAATCTCA
CAATGAGCTCTGcAAaCTCTCGGAACAaCAGCAGTCTCTCTGGCGGCACGACCTCGGGCAGCTCAGCCGCCAGCGTCACTGCAtcTGTCATtACAAAGTC
TGCCACGATGAGCTCGTCTCGGGCGCCAGTTGCCTCGCTTTGGGCGTTCCGAATACGCCTCAATAACTGCTCCAGACGCCCACCACTGAGCCGCACCCcA
CATTCCGCTAACAACCGCCTGCATTCGTAGAaCTCGAGGAGAATGGCGCCGGACCcATCGCTCGACTCCGCGTCGCTTCGACTGGGGCTCGTAGCCGGCT
TCGACGGGgAGCCCGTCACCGTAGCCATATACTGTCgaTAGAGTACACGCAGTTCTGTATTGGCTCGTATGACGGCGTGCTCGATGAGCTTTCGTTCGCG
TTCCCTCCCTTCAGAcGTCGGTAGAATGTCGTCCACGTAGAGAATGATCTTACCACCGCTACCTCCTTCCACACGATCTTCGACCACCGCTCGGTCATCT
CGAAACTCGCCTACAAACACTCGACCGTCCTCATAGAAGAACGCACCACGTCCGTGCTTAGCGTTGGACTGCCACTCCCCCGTGTACCTCGCGCCATTCG
CATAGTAGAACgTGCCTCGGCCATGGCGCACGCCGTCCACGAAATCGCCCTCGAACCAGTTCTTCTCGCGCTGCTTCGTGGTAGCTGCTTGGCTTGGAAC
ACCCAGCCAGACGTGGCGACCAAAGCCATGAGGACGGTCGTTCGACCACGAGCCAACATACTTCTCGACGCATTGACCGTCCGTCATCCACAGCATCGTC
CCCATGCCGTTCTTGACGTCgTCGATCCACATGCCGCTGAATACGTTGCCACTCGCGTACCGCATCTCGCCTCGTCCATGGCGCTTCCCACTCACAAACT
CACCTTCATACCGCACGTTCCGATCATCATCAAACACTAGGACGCCTCTGCCGTGTGgTAGACCATTGTTCCATtCCCCcTCATAaCgCGCGTCGCTCcT
cGcccCGa