Description :
From Genome Similarity Track
Location :
Scaffold_1011:2993- 5346
Transcript NameFunction/comments
Phypl_g12045propionyl coenzyme A carboxylase (Pi-PCC1)

Sequence
2353 bases(100 bases per row)
CTGTCCGGCGCGCGCCGGCGCGCCCCCGCGGccctgcgccagctgcacgcggccCCCACGGAGAAGCTCTTCGACAAGATCCTCGTGGCCAACCGCGGCG
AGATCGCCGTGCGCGTCATGCGCacgtgcaagaagctgggcaTCAAGACCGTGGCCGTGTACTCGGAGCCCGACGTGAACTCGGTGGCCGTGCGCATggc
cgacgaggccgtgTGCGTGGGGCCCGCGCCCTCGAGCCAGAGCTACCTGAGCATCCCCAAGATCGTGGCGGCCGTCCAGGCCTCGGGCGCGCAGGCGGTG
CACCCGGGCTACGGCTTCCTGTCGGAGAACAAGGACTTCTGCGAGGCCCTGGAGGCCATTGGCGTGGCCTTCATCGGCCCTGGCCACGCGGCCATCCAGG
CCACGGGCGACAAGATCGAGTCCAAGCAGCTGGCCATGGACGCGGGCGTCAACACCATCCCGGGCTTCCTGGGCGTGATCGAcacgcccgaggacgccgt
caaAGTGGCCCAGGAGACCGGCTACCCCGTCATGATCAAGGCCAgtgccggcggcggcggcaagggCATGCGCGTCGCCTacaacgacgaggaggtgcGC
ATGGGCTACCGCCTgtcgaaggaggaggcggccagcagcttcgaagACGACAGGATGTTCCTCGAGAAGTTCATTGAGGACCCGCGGCACATTGAGATCC
AGCTGATCGCAGACTCACACGGCAACGTGGTGCCGCTCCCCGAGAGAGAGTGCTCCATCCAACGCCGTAACCAAAAGGTGATCGAGGAGGCGccgagcgt
gctgctggatccgGAGACGAGAATGGCCATGGGCCAGCAGGCGGCCATGCTGGCTAAGAAGGTGGGGTATGTGAGCGCTGGGTCGGTCGAGTTCCTGTGC
GATAAACACAAGAACTTCTACTTCTTGGAGATGAACACGCGTCTGCAGGTGGAGCACCCCGTGACGGAGCTCATCTCGCGCGTGGACctcgtggagcaga
tgatTCGCGTGGCGGCAGGACATGAActgcccaaggagctggtcgacgGACCTGTGAAGATCCACGGCTGGGCTATGGAGAGCTGCGTGTACGCTGAGGA
CCCGCTGCGTGGCTTCCTGCCATCAACCGGACGACTTCTGCAGTACGAGGAACCCGTCCACCTTAAGGGCGTGCGTGTGGACTCGGGCGTGAACGAAGGC
AGCGACATCTCCATGTTCTATGATCCGATGATCTCAAAGCTCATCACGTACGGCAAGGACCGTTCGGAGTGTTTGGAGCACATGAAAACGGCGCTGGACA
ACTACGTGATCCGTGGACCCGGCAATAACGTCGCATTCCTGCAGGATGTTTACCGCCACCCTCGCTTCGTGAGCGGCAAGATCACCACGAAATTCATCGA
GGAGGAGTACCCGGACGGTTCTGAAGGTGTCAAGCTGACGGCGCCCGAGATCGAGGATCTCAGAGTGGTAGGCGCGATCATGCACCTGAAGAAGGCTAGC
GCTAGCAGCCAGATCTCGGGCCGCATTCAGTCGACGCCCGCGGAAGGTTTCGGCTCGTTCGACTCGCTAAACGAAGACGAACTGGAGTTTGTCTCGGAGC
AGGCAGGGGTTGTTCCTCGCCTGCGTGCAATTGCTACCAACATTTCATCTAAGGAATTGATTGCTCTGGCAGAGCGCAACGATCTCAAGGACTTGGGTGC
TCANCTAAAGAATTGATTGCTCTGGCAGAGCGCAACGATCTCAAGGACTTGGGTGCTCAACTGGCGGTTAGCATCGATGGCCCCTTCGGTGAGTCGAAGC
CcgttgttgtcgtcgaggtcgaggtcGAGAACAAGCGCCACTGCACCGAGACGGTGACGCTGGCTTTGGTGGACAACAAGTGGCACGTTGTGGGAGATGT
GGACTGGTCGCTGAATGGCCCCTTGTTCAAGGCGTCGTACGCGAAGCAGGACGGGGCAGCTGACGTGTCGTTGGCGTCTCAAGTGCTGCAAACGCTGCCC
GAGGGTTTCCGGCTTCAATTCCACGGTGCCGTTCATGATGTGGTTGTACGCAatgagctggaggctgcgTACGGCAAGCACATGCAGCCAAAACCCGAGG
TCGACACGTCCAACTTGCTGCTATGCCCGATGCCCGGTATGCTCATCTCTGTGGCCGTGGAGGTCGGCCAGCATGTGGAGCTTGGTCAGGAGCTGGCTGT
CGTGGAGGCCATGAAAATGCAGAACGTGCTTCGCTCCGAGAAGAGAGGCGTTATCAAGAGCATTgtgcatgctgctggcgactcgctcaaggtggacgaA
ATCATTCTCGAGTACGAATAAGCGCTTCGATGGTACGCTACGGAGACAGCACT