Description :
From Genome Similarity Track
Location :
Scaffold_37:29926- 31497
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_37-fgenesh-gene-0.3Vacuolar protein sorting 39

Sequence
1571 bases(100 bases per row)
TCCCCtcTTcATCATCAACGaCACTCAGAAGAACGTCACTAGGGGGCGGCAACATGGCGGACGCGGCGGATGCCGACCAGCGCGCGGTCTTCCGCACGAC
GCCGCTGGTGACGGGATTCGACGGTAAGATCCAATGCCTCACGCACTACTCGTCACGTGTGGTCGTGGGCACGGCCGACGGTCGGCTCGTGATGTTCGAC
ACGCGCAAGGGCCCGACGACGCCACCTGGTGCCTTCTACCAGTTTGCCCACGGTCGCCcAGTCGAGCAGCTCCTTGCCGTGCCACATATCCGCATGGTTA
TTGCTGTCTCGAACGGCGAGCTTTCTGCACATGGCGCGACTGATTTGAGGCCACTCGACTTTGATTTCTCCcAGGCTAACGCGCATCAAGTCAAAGTGAT
CTGCATTAACCAGCGTGGACCaCCACATTTCCGACTGGGtGTTGCGTTATTGCGACGAAAGGCCGTGATGATCTACCAGTATCACAGCTCCGATAAGTCG
TACCAGTACCTTCGTGAATTCTCGACCCAGGAAGTACCTGAGACGATTTCATGGTACAGGAACAAGGTGTTTGTCGGCTACCGAAAGGATTACTACATTC
TGAATGATAGAAGTGGAGAGGCGCAGCCGGTGAACTCTCCTGGTATTCAGAGTCCGCAAGTAATGCCTGTGGTCAAGCTGCTACCGAACGAAGAAGTCCT
TCtGACCGTCATGGATAAGGTAGGTGTCTTCGTCGGTCTCAACGGTGAACCGCTCCCCAAGAACTCGATCAACTGGGCACAAGCACCGACTTCTGTAGAG
TTCACGTCGCCGTACATTAtCGGTTTTGTGCCAAAGGTTGGTGTCGAAATCCACAACTCAACAGACAACTCACACGTGCAGACACTACCCATCAGTCACG
TCACGAGCATCTTCTGTAACGGAATGAAGTTCGACATGGAACCTCGTCCCAGCGGTGACTCAGAAAACGTTGTTGTGGTCGGTGTACGAGAAAGCGGCTC
GAAGTCTTCTGTGATGAAGGTTGAACAGATGCCAATGGACCAGCAAATTGGCGAACTACTCGATCGCGGCAAGATTCAGGAGGCACAGGATATTGTGAAG
AAGTCGATCAGTGGCCTTCCGTCGGAGAAACAGAAGAGCAAGACGAAGCGCTTCCAACGACAGGCAATGGTCGCACTGCTCCGGCGACTCGAGTTTGACG
TTGCAGTTGATTACATGTTCCGCTCAGCTGTCGAGCCGTGTGAGTTCATCGCCTTCTTCCCAGAATATCAGTGCTCTTCATTTGCTTATGAGCCCGCAAT
TCTGAAGCCAGAAGTTCTACCTCGTGGCGCTAGCGTGTCGCCAGACATTACCGCTGTCATCAACGAGATCCTGAAAAGTCAGAACGCAAATTTGGCCAGC
GAAATCGTGCGAGCCGATCCACAAGATCTTGTAGAAGCTGCCAAGAAGGCGTTGATGAAGTTCTTGGACAAGTACAAATCGTACGTTCGCGAGAAAGCTC
AATCGTCGCGCAATCGTGCGCCGTCTCGAGCCCGTGCGGTTTCATCAAGTGCTTCTTCGAGCGCTCCAAAA