Description :
From Genome Similarity Track
Location :
Scaffold_16:299189- 304449
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G006769Similar to ACX1: Peroxisomal acyl-coenzyme A oxidase 1 (Arabidopsis thaliana)
Pytul_DAOMBR144PYU1_G006768Similar to tilS: tRNA(Ile)-lysidine synthase (Chlamydia muridarum)
Pytul_DAOMBR144PYU1_G006767Similar to H27M09.2: DNA-directed RNA polymerases I%2C II%2C and III subunit RPABC1 (Caenorhabditis elegans)

Sequence
5260 bases(100 bases per row)
CCACACGGAGCGCTACAACTTTGGCATCAAGAAGGCGTACAACTGGGTGCAGCTCGTGCGCGCGCACGGCTTCACGGACCCGTGGGAGCTCCAGACGCTC
TACGCGGCCATGGGCGAGCCATTGGGCATCGACGTGCACCGCGCCATGTTCGTGCCGACGCTCGAGAACCAGGCTGACGAGCAGCAGCAGCAAAAGTGGC
TCCCGCTCGCGCGCAACTTCAAGATCACGGGCGCGTACGCACAGACCGAGTTGGGCCACGGCTCGAACGTGCAGGGCATTGAGACCACAGCGCACTTCGA
CAAGGCCGCGCAAGAGTTCATCATCAACTCGCCAACGCTCACGAGCCGCAAGTGGTGGCCTGGCGGCCTCGGCAAGACCGCGAACCACGCCATCGTGCAT
GCGCGGTTGTTCCTCGAGGGTAAGGACGTCGGCGTCCAGGCGTTCCTGGTGCAGTTGCGCTCGCTCAAGAACCACGAGCCGCTCCCAGGCATCGAGGTCG
GCGACATTGGCCCCAAGGTCGGCTTCAACGGCGTCGACAACGGCTACTGCGCGTTCGACAACGTGCGCATCCCGCGCGAGAACATGATGATGCGGTACGC
CAAGGTGCTCCCCGACGGCACGTTCGTCAAGCCCAAGAGTGACAAGCTCGTGTACCTCACGATGGTGCAGGTGCGCGCGTATTTGATCTTCAGTTTTGCG
CGCACGATGGGCATGGCCGCGACGATCACGACACGCTTCAGCTCGGCGCGTGTCCAGGGCCGCACGCCCTCGGGCAAGGGCGAGTTCCAGGTGCTCGACT
ATCAGAACCAGCAGAACGCGTTGTTCCCGTTCATCGCGATCTCGTACGCGGCCAACTTTGCCGGCACGTCCATGATCACGATGCACGATGCGGCGCTCAA
CATCATCAAGAGCGGCAAGGGCTCGTTCGGCTCCAAGCTCGCGGAGTTGCACGCCGTGTCCTCGGGGCTCAAGGCGTGGCTCGCCGTGAACGTGAGCAAC
GGCATCGAGACGTGCCGTCGCATGTGCGGTGGTCACGGCTTTACGCAGTCAAGCAACCTGGGTCACATCTTTGCCGAGACCGTCGGCGCCAACACGTTCG
AAGGCACGTTCGACGTGCTCGTGCAGCAGCATGCTCGCTACCTACTCAAGGTGCTCGTGTCGCTTCCGTACAAGAACGACGAAGCTAACGAAAGCAACAG
CACGAGCTTCCTGACACGTGCCAAGCAGTACTTGGACCCAAGCCTGCGCTGCAAGGCCCAGAAATCCGAGGACTTTGGCGACTTCAAGCTGCTCCTCGAG
GCATTCGAAGCGCGTGCGGCACGCATTGTCGTGCGTCTCGCCAAGCAAATGCAGGCCACGAACAACGACGGCAACGCGTGCATGGTGCTCATGTCGCGCG
CCTCGACGGCGCACGCCGAGCTCATGCTGCTCGAGGCGTTCGTGAACGGCGTCGAGACCGTGCCAGTGGGTGCATCCAAGACGGCCGTGTCCAACTTGTG
CGCGCTCTTCGGCGCGTGGCTCGTCGTGAACTCGCTCGGGGACTTCCGCGAGGACAACTACCTGAGCTCGGCCCAGGGCGACGCCGTGCGCCAGCAGATC
CTGCGCCTGCTGCCGGTGATCCGCAAGAACGCCGTGCTGCTGACTGATGCCTGGGACTTTACGGACTTCGAGCTCAACTCGACGATCGGCCGCTACGACG
GCGACATCTATCGCGCGCTCGTCAAGCGCGCCGCCGACGAGCCACTGAACAAGACGCAGGTCGCCGAGAGCTACGAAAAGTACTTGAAACCGTTGATCCA
GTCGGACTTGTAAGTCGTAGGATGAAAAAGAAGCCACATCTGTAGGGTATATTTGCCATGCACCAGCATACAAAAAACCAATGAAAAAAAATAACAATAC
ACTTTAGTTGCTTCATAAGGTAAACAACTTCGTAGGGTATATGTTAAGAGTCTTCCGTGACTTGGTTGGTGTACTGGAGCTGGACGTGTACCCATTTCGC
GGCCTCGTGCGCATCCTCAAAGGCGCCGCGCGACGCGACAACGGGCACAAAGTCCGTGATCACCTTCTCGAGCGTACGCAGCGCGGGGCGGCGGTTCTCG
CTGTCGAGCACCAGCTGCGGCGCGTTCGGGAAGACGTACTCGAGGCCGTTGCCGCGGACCACGTCCCACATGGTCAATGGAGCTTGCGCCTGGAGTTCCT
GAGCCTTGGGGTCGTCACTCTCGAGCACGGAGGTCGTGAGTGTCCATGGACCAAACGTGTACGTCTCGTTGATATTGACAGTCGTGAGTGGCCGCGTGTA
CGGCGCGCGCGGGAAGAAGCGGTCGCGGAAGATGATGAGCTTGCGGTCGGCAGTGATGTAGGACCGGTTGCCCTTCTTGAGCGTGACCCAGGCGCCCGTC
GTGCCGTTGTGGCGCGCGAGCTTCATGATCAGCTCGCGGATCGGCTTCTCGCGCACCATGCTGTTGCCCATGATCGAGTGGCAGATCGACCGCAGCACTT
CTTTCCACACGAAGAACGGCTGGTTCACCAGCAGCGTGCAGTCAATCCACACGGCGACCTCGGACGTGCCGACGCTCGCCATGATTGGCGCCAGGATGTT
CTGGTCGACGAGTTCAGCGCACTGTGTCGACTCGGCGCCAAGGTTCGACAGGTTGTTAAGAAACCCGTCGCCGTACAATTCGCGGAGCAGCGGCACGAGC
TGGCTGCGCAACTTGCCGCGCGTGCTCCACGCTGGCGTTGTGTCCTTGAAGTACGGAACTCCGTACCGGTGCGCAAACTCAAAGATCACATCCTTCTCGA
AGTCCAGCAGCGGCCGCCAGATGCGCACGCCGTTCACGATACTCGACTCGCTCATGCCGTTGAGGCCCAGGAGACTCAGCCCCTTCATCATGTTGGAGAT
TACGTTCTCCTGCACATCGCCGCGGTGGTGGCCAAAGCACATGCCTGGCGCACCGTACTGCGCCATCACCTGCGCGTACGTCGCGTACCGGATCTCGCGC
GAGATGCGCTCGTAGTCGTCGCGCTTGGTCGAACTGCGCTTCACCTCGTCAATGCGGCGCACGTGGAACAAGATCCCGAAGCGCTCGCACCACTTGCGCA
CGTACTCGCATTCGGCGTGGCTCTCTTCGCGGTTGCCGTAGTCCAAGTGCACGGCGACGATCGTGAAATCGTTGTGCAGTGGACGCAACTTGTGCAGTAG
ATACGCGACGACCATGGAATCGACGCCTCCAGACAGCGACACGGCCATGTGCGAGTACTTCTTCGCATCCATCTTGACCAGGTACTCGTTCATGGCCTTG
TAAAGCCGGTGCTTTGGCATGTCGCTCTCGTCCGTGACCATGAAGTGGCGCTCCAGGATGTCGTTGTCGCTCTCGACCGTCTTCTCGCCGCGCAGGTGCT
GCAGGCGGCTCTGCGTCGTGCGGCGGAATTTCTCGAGCAGGTCGATGTGCGCCGTCTGCAGTGTCTCGCGCTCTTCAATCGTGTCCAGCAGCGTATGCAG
TCGCTCGGATGTCGGCGTGTGGCGCATCGGCATCATCACAAACACGAACTGCGGCACGTCCAAGTTCACGTGCCAGTTCTTGGCCACAAACGCCTGCGCC
AATGCCAACGCGTGTTCGTCATTGCGCCGCAGCTGCTCCTTGTTCTCGTGGCGGTACACGTGGCGCGAGAACTGGTCCAGGAGCACGATAAGCGCCACGA
ACGTGTCACGCTGCTGCTGCCAGTGCTCGAGCTCGTGGCGTTGCGCCTGCTCGAGCAGCGCGCCGAAGCGCTCGGCGATCGTCGCGTCCATGACGCGCTG
CTTGTCGGACGCCTCGGGCGGGAACCACTTGGCGCGGTAGTTGTCCTTCTGGTCGCCGCCGAACCAGAAGTCCAGAATCGCAAGCGCTTCCGGCGCGACG
CACGAGGAGGAGCACGAGGAAGCCATTGGTGCTTTTGGAAATGACTGTGTGCGACAACAGTCGACACCAGCAGTTTCGTAAGTGCGAGGACGACTGCGTC
TGCGCACTTTAGACTTTGATAGGCAACAGACAACATAACTGCCTTACAATTATTATTGAGATGCACAGTACTAACTTAGCGAGTCTACCTGTCAAAACTG
TGGCCTTTTTGCCCTTTACTATAAACGTGATTTTTTATATCTTTATGTTTTCTTAAAATTGGTAAACAATAAGTATAATAAAACAAATCCCGAAAACAAT
AAAAAAAGCAGATGTGTCCCGTGTTGGAACCTTCTAATTCGGGACGTGCGCGGTGTGCCCTTGGCGCCCACTCACATAGCTGGCGCTGCCCAAAAGCACA
TTTTCGCTCGGCCAAGCGATCAATCCTCCATATCGTCCACTGCGCGCGCGTCCTCCTTGCGCGTAACAGCAGCAGCAGCAGCCCTCTTCCTTCCTACAGC
CAACAGCATCAGCCTATCGCCATGTCGGGACTCACTCCAGAAGCGTCGCGTCTCTACCGCGTGCGCAAGACCACCGTCAAGATGCTCCACAACCGGTACG
TCTGTCCCGCAAGCAACATTGAGGGAAAAAAAGACCGGAAATAGGCTGGCGCCGCATTTCTTGGTGCTTTGCCGTATGCTTGGAGGGAGTTGTATGACGG
TCATATATATGGACTAACACTTGGGTGTATGTCTGGGTGTATGCAGTGGCTACATTGTGAGCGAAAACGAGTTGGTGATGACGCCTGAATCGTTCCAGCA
CCAGGTATCATGTCTTGAAAGACTCTCCTTTCCCTGTCGTCGGTCCCAATGCTCCTTTGGATATTCACTCGCATGCGGCGTCTCTTTGTGTTGTTTTGTA
GTTCGGCGACAACCCAACGCGCGAAATGATGACCATTCTCGTACGTCTGTTCTGCTTGCATTGGTTGGCTTGTAGCACAGCTCGTGCTCACACGTGTATA
TCTATGGCAGGTGGAGAAAATCGACGACCCGAGTGATAATTTATTTGTGTTCTTCCCAGAGGATACGAAGGTCGGCGTGAAGCCGATCCGCACGTTCTGC
AACCGCATGAAGGACGAGAACGTGAGCAAAGCGATCCTGGTCGTGCAGGAAGGCATCACGCCGTTCGCGCGCCAGGCGCTGAACGAGATGGCGCCGCGCT
ACAAGATCGAGCACTTCAAGGAGACCGAGCTGCTCGTGGATATCACAGAACACACGCTCGTGCCTGTGCACCGTGTGCTCAACCGCGACGAGAAGGCCGC
GCTCCTGAAACGGTACCGTATCAAGGACTCGCAATTGCCGCGCATGCAGGTCACGGACCC