Description :
From Genome Similarity Track
Location :
Scaffold_17:299121- 300603
Transcript NameFunction/comments
Physo_113879hypothetical protein

Sequence
1482 bases(100 bases per row)
GACTGGCACGCTGCTGCCCTCTCTGAATATCGGTCGCTCATGGAAAACCAAACGTGGACACTGGTGCCGCGGCCGCACAATCGCAAGGTGCTCCAGTGCA
GATGGGTTTTCGTGCGTAAGCGCGATGAAACTGGTCGCGTTGTGCGCTTTAAAGCTCACCTGGTCATTAAAGGCTTTCAGCAAAAGTACGGTATCGACTA
TACAGAAATCTTCTCTCCTGTCGTCCGCATGGAAGTCCTTCGACTGCTGCTCACGCTTGCAGGAATCCTTGACTATGAAATTGAACAGATGGACGTTAAA
ACGGCTTTCCTCAATGGTTCACTCGACGTAGAAATCTTCATGGAACAGCCTGAGGGATTCACCTCAAAGGATCGCCCTGGCCTCGTATGCAGCCTTGGTA
AGAGCCTATGTGGCCTCAAGCAAGCACCTCGTGTCTGGTATCACACCTTTGCTAAGTACCTCGAACGTCTGGGTTCACTCGCCTAGTTAAGGACCGTTGC
GTGTTCTTTAAGGTTATATTCAATGCGCCGTGTTACATCTCGGTTTACGTCGATGGTCTGCTGATCATCTCCCCGTCCAAACATGTCGTTGCTCGGGTCA
AATCGGCCCTGAGTTCCGAGTTCCACATGAACGATTTAGGGGGAGTATCCTACCTCCTTGGCTGGACAATTGAAAGGAACCGAGCTAACCGCTCCATCTT
CATCCACCAAAAGAGCTACGCCACCAAAGTGCTAGATAGATTCTCAATGTTAGACAGTCACCCAAAGAGCACGCCAATCGCGCAGAAGCTTAGTGCCACC
GACTGTCCTACCGACGACGATAGTAAGCCTATGATGGCCAACAAACCGTACCGAGAAGCTGTAGGTAGTTTCATGTACCTGATGACGGGTACTCGTCCTG
ACCTCGCCTACATCATCCGTGAAGTTAGCCAGTACCAGGGCTGCCTCACTGGAATGCTGTAAAGCATGGTCTTCACCACCTCAATGGCACAAAAGACTTT
GGCATCACTCTTGGTGGAGTGGAAAACCTCGAGCTCCTACAGTCAGATGAATATCTCATGGCTTATACGGACTCAGACTACGCAGCATGCCAAGCACACG
ACGCTGCATCGGTCGTTATATCACTATGTTCTGCAACAGTCCCATTAGCTGGGTCTCACGGAGACACCACACAGTCGTGCTCTCCACAACGGAAGCAGAG
TATATCGCACTCTGCTACTGCATGCAAGAGCTGATCTACTTAAAACTACTGCTAAGAGAACTAGGCTACGAGAGCTCAAAGCCCACACTGATCATGGAAG
ACAACCAAAGTTGCATTAAGATATGCAACAACCCAGAGCTTCACGGCAGGAGCAAACACATTGACATTAAGTACTTCTTCGTACAGGAGAAGGTGGCGCG
CAAGGAGTTCACTGTCAGCTATTGCAACACCAATGCAATGTGCGCTGACATCTTCACTAAACCTTTAGCGAAGCCACTATTT