Description :
From Genome Similarity Track
Location :
Scaffold_1798:2991- 4532
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1798-fgenesh-gene-0.014-3-3 protein epsilon

Sequence
1541 bases(100 bases per row)
AGCTATTTATACCGCCCGCCCACGCACACCCAGATACGACAAATTTCAGCCCACACCCAATCCACAGACCGTTTGGACGGAGGTCTTGAGTGTGGTGGGC
GACCGTCGATACCAGCACTCCAGATGGAATTGACAATCTCTTGCCTTGAGCCAATCACCAGCTTTGCGGCCAACCATTCGCAACGGCAAGCCCCACTTTA
TGAACCCATGATTGGATGAAAAAGATGCGTCATTGGTTCATCAATCCAATCGATTCGGTTAAATTAATCCATTTTTATGATTCGCTGAAATGTGCGCGTC
ACAATACCTGTGAGCCAGTTATATTGCTTAAGAAGAAATACCACACGCATTCTTGCTCAGAATGATGGTTGAAGCAACTTTTTGACAAACGTCAGTCTCA
CCTCGCCAAGTTCAACGTGGCGCAGCTCTTCGAGCCCACTCACCAGTAGCAATAACGACACTCTCGTACACACATGAGCTGCAGACAAGCAGTCAAAGGG
CACAGCGTACGCGATGCTGTATGCACGCGCTTCATTCACTGTGCAGATGAGCAGGCGTTCACGGTTGGCGGCAAAACGAAGTTGCTGATCCCATTTCCTC
AACGGGTGGTCGGGCTAGAAGATCAACTGGCTCCAGCCCGTGGCTGTCGGCGCTGACAAGAGCAACGAGGCCTCATGAAGAGCAGAGAGTATAGTTGCTC
ATTGTCCACTTTGCTCAAACACGCGCAAACGACCTCCAAGCCAACCCCCCAAGCACCAAGCACCATTTCTCCCTCTCATCAACCTCTGCCATGGACCGCA
ACGCCCTCACGTTTCTCGCCAAGCTGGACGAGCAAGCCGAGCGGTAAGTATTGCGGGCTTGCTTACTCTTTACTGAATTACGTGGTGGCATGCATACTCA
TACTTCCGTGTATTACTATTGCTCCATGTCATGTATGCAGCTACGACGACATGGTCGGCCACACCAAGCAAGTGGCGACTAGCGCCGACGACGAGCTCAC
GGTCGAGGAGCGCAACTTGCTCGCAGTGGCGTACAAGAACGTTATCGGGTCTCGTCGTGCGTCATGGCGCGTGATCTCGTCCATCGAAAACAAGACCAAG
AGCGCCGACATCACGAACCGCAACATCAAGATGTACCGCCTCAAGATCGAGCGCGAACTGGCGGAGCTTTGCAATGACATGCTCGCGATCATTGACAAGC
ACTTGCTGCCGAAGGCGGACTCGGATGAGAGCAAGGTATTCTACTACAAAACCAAGGGCGACTACTACCGCTACATCGCGGAGTTCCAGGTCGACGACGA
GCGCGCGGAGAGTGCACGCAAGGCTCTCGACGGGTACAAGGAGGCGTCGACGATCGCGATGGCGGAGCTCACACCGACGCACCCGATCCGCCTGGGCTTG
GCGCTCAACTTCTCTGTGTTCTACTACGACATCCTCAACTCAAGCGACCAGGCGTGCGGCTTGGCGAAGCGAGCATTCGACGATGCGATTGCCGAGCTGG
ACACGCTCTCGGACGAATCGTACCGCGACAGTACGCTGATC